Mutations.

Slides:

Advertisements

Similar presentations

Advertisements

Mutations (Ch. 17) Mutations Point mutations – single base change silent mutation – no amino acid change – redundancy in code missense – change amino.

Mutations Changes to DNA

AP Biology Chapter 17 Mutations: Point, Frameshift and Examples.

Ch Mutations Section Objectives:

Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

Point Mutations Silent Missense Nonsense Frameshift.

Lesson Four Structure of a Gene. Gene Structure What is a gene? Gene: a unit of DNA on a chromosome that codes for a protein(s) –Exons –Introns –Promoter.

the Genetic Code Shown as mRNA 5′ → 3′ 64 codons Redundant

Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

Protein Synthesis Transcription and Translation RNA Structure Like DNA, RNA consists of a long chain of nucleotides 3 Differences between RNA and DNA:

1.Most genetic disorders result from a mutation in one gene. a.Mutation: a change in an organism’s genetic material (DNA) 2.A mutated gene produces a.

AP Biology Mutations Unit 5B.5. AP Biology Changes in genotype (DNA) can result in changes in phenotype  Alterations in DNA sequence can lead to changes.

MUTATIONS No this can’t happen with just mutations.

 BUILD-A-BUG ACTIVITY  Build your bug and turn in to your box  Mutations Notes  Mutations practice QUIZ NEXT CLASS: Transcription and Translation TUESDAY.

BI. 4c Students know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene, or the sequence of amino acids in an.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

DNA Mutations. Base Substitution: A substitution is a mutation that exchanges one base for another (switch A with a G) 1. changes a codon to one that.

Lesson Four Structure of a Gene.

Lesson Four Structure of a Gene.

DNA/GENE MUTATIONS.

“How does it affect the protein?”

Gene Mutations.

Review: Can you tell the story of protein synthesis?

Types of Mutations.

DNA and mutations SC.912.L.16.4.

Chapter 17. Mutations

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Mutations (Ch. 17).

Mutations in the Genetic code

Mutations in the Genetic code

Types of point mutations

Mutations changes in the DNA sequence that can be inherited

Entry Task Apply: Suppose a template strand of DNA had the following sequence: DNA: T A C G G A T A A C T A C C G G G T A T T C A A What would.

Entry Task Apply: Suppose a template strand of DNA had the following wild-type gene sequence: DNA: T A C G G A T A A C T A C C G G G T A T T C.

Mutations (Section 17-5) Now, that you know how gene expression works, let’s see how changes in the gene affect how the protein is made.

Do Now What is the central dogma of biology?

What can you infer from this cartoon?

Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.

Changing the world one nitrogenous base at a time…

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Mutation Notes.

Mutations (Ch. 17).

Gene Mutations.

Presentation transcript:

Mutations

When do mutations affect the next generation? Point mutations single base change silent mutation no amino acid change redundancy in code missense change amino acid Changes the final protein nonsense change to stop codon Stopping prematurely When do mutations affect the next generation?

Point mutation leads to Sickle cell anemia What kind of mutation? What structure has the mutation? RNA or DNA

Mutations Frameshift shift in the reading frame changes everything “downstream” insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene?

What’s the value of mutations?