Volume 43, Issue 6, Pages 940-949 (September 2011) An RNA Pyrophosphohydrolase Triggers 5′-Exonucleolytic Degradation of mRNA in Bacillus subtilis  Jamie Richards, Quansheng Liu, Olivier Pellegrini, Helena Celesnik, Shiyi Yao, David H. Bechhofer, Ciarán Condon, Joel G. Belasco  Molecular Cell  Volume 43, Issue 6, Pages 940-949 (September 2011) DOI: 10.1016/j.molcel.2011.07.023 Copyright © 2011 Elsevier Inc. Terms and Conditions

Molecular Cell 2011 43, 940-949DOI: (10.1016/j.molcel.2011.07.023) Copyright © 2011 Elsevier Inc. Terms and Conditions

Figure 1 Conversion of Triphosphorylated to Monophosphorylated RNA by Purified BsRppH (A and B) Release of orthophosphate from the 5′ end of triphosphorylated RNA by BsRppH. Triphosphorylated ΔermC RNA bearing a 5′-terminal γ-32P label and an internal fluorescein label was treated with purified BsRppH or BsRppH-E68Q (75 nM), and reaction samples isolated at time intervals were analyzed by (A) gel electrophoresis (with subsequent detection of radioactivity and fluorescence) or (B) thin layer chromatography beside the same RNA treated with EcRppH (with subsequent detection of radioactivity). (C) Conversion of triphosphorylated RNA to monophosphorylated RNA by BsRppH. Triphosphorylated, diphosphorylated, and monophosphorylated GA(CU)13 bearing a single 32P label between the first and second nucleotides was treated with purified BsRppH (75 nM), and the radiolabeled starting materials and reaction products were subjected to alkaline hydrolysis and analyzed by thin layer chromatography (bottom) or examined by gel electrophoresis without hydrolysis to confirm RNA integrity (top). (D) Inhibition of BsRppH by a 5′-terminal stem-loop. Triphosphorylated rpsT P1 and rpsT P1+hp RNA bearing a 5′-terminal γ-32P label and an internal fluorescein label were treated with purified BsRppH or BsRppH-E68Q (7.5 nM), reaction samples were isolated periodically and analyzed by gel electrophoresis, and the radioactivity remaining in the RNA was plotted as a function of time. See also Figure S1. Molecular Cell 2011 43, 940-949DOI: (10.1016/j.molcel.2011.07.023) Copyright © 2011 Elsevier Inc. Terms and Conditions

Figure 2 Effect of BsRppH on the Decay Rate and Phosphorylation State of mRNA in B. subtilis The decay of ΔermC and yhxA-glpP mRNA in wild-type and ΔrppH B. subtilis cells was monitored by northern blot analysis of total RNA extracted at time intervals after inhibiting transcription with rifampicin. A probe specific for tRNACys was used to confirm that an equal amount of total RNA was loaded in each lane. In addition, the 5′ phosphorylation state of ΔermC or yhxA-glpP mRNA in the same strains was examined by PABLO analysis with oligonucleotides X90 and Yerm1 or, after cleavage with DNAzyme YhxA1, oligonucleotides X32 and Y0, respectively. The PABLO ligation product of yhxA-glpP comigrated with an electrophoretic marker 214 nt long, equal to the sum of the lengths of the 5′ yhxA-glpP cleavage product and X32 (data not shown). (A) Decay of plasmid-encoded ΔermC mRNA. (B) Decay of chromosomally encoded yhxA-glpP mRNA. (C) Semi-log plots of mRNA concentration as a function of time after rifampicin addition. (D) PABLO analysis of plasmid-encoded ΔermC mRNA (left) and chromosomally encoded yhxA-glpP mRNA (right) in wild-type and ΔrppH cells. Representative experiments are shown; mean values and standard deviations from multiple half-life and PABLO measurements are provided in Table S1. See also Figure S2. Molecular Cell 2011 43, 940-949DOI: (10.1016/j.molcel.2011.07.023) Copyright © 2011 Elsevier Inc. Terms and Conditions

Figure 3 Comparison of the Decay Rate and Phosphorylation State of Full-Length and Mini yhxA-glpP mRNA and Complementation of a ΔrppH Mutation Half-lives and PABLO ligation yields were measured for plasmid-encoded full-length and mini yhxA-glpP mRNA in wild-type and ΔrppH B. subtilis cells and in ΔrppH cells in which BsRppH or BsRppH-E68Q was ectopically produced. Bar heights and error bars correspond to means and standard deviations from multiple experiments, the numerical values of which are provided in Tables S2 and S3. Black bars, cells containing active BsRppH; gray bars, cells lacking active BsRppH. (A) mRNA half-lives. (B) PABLO yields. Molecular Cell 2011 43, 940-949DOI: (10.1016/j.molcel.2011.07.023) Copyright © 2011 Elsevier Inc. Terms and Conditions

Figure 4 Effect of a 5′-Terminal Stem-Loop on the Decay Rate and BsRppH Sensitivity of Mini yhxA-glpP mRNA The decay of (A) mini yhxA-glpP mRNA or (B) mini yhxA-glpP+hp mRNA in wild-type and ΔrppH B. subtilis cells was monitored by northern blot analysis of total RNA extracted at time intervals after inhibiting transcription, and band intensities were plotted on a semi-log graph. These two transcripts were identical except that mini yhxA-glpP+hp mRNA contained a 5′-terminal stem-loop (AGGGCCGAAGCTTCGGCCCT) that did not change the sequence of the first four transcribed nucleotides. See also Figure S3. Molecular Cell 2011 43, 940-949DOI: (10.1016/j.molcel.2011.07.023) Copyright © 2011 Elsevier Inc. Terms and Conditions

Figure 5 Degradation of Monophosphorylated yhxA-glpP mRNA by RNase J (A) Effect of RNase J1 or RNase Y depletion on the longevity of yhxA-glpP mRNA. The half-life of the chromosomal yhxA-glpP transcript was measured in wild-type B. subtilis cells and cells in which RNase J1 or RNase Y produced under the control of an IPTG-inducible promoter had been depleted by removing IPTG from the growth medium. Bar heights and error bars correspond to means and standard deviations, respectively. (B) Accumulation of monophosphorylated yhxA-glpP mRNA upon depletion of RNase J1. PABLO analysis was performed on the chromosomal yhxA-glpP transcript extracted from wild-type B. subtilis cells and cells in which RNase J1 had been depleted. In each case, the transcript was cleaved site-specifically with DNAzyme YhxA1 to improve the electrophoretic resolution of the assay. See also Figure S4. Molecular Cell 2011 43, 940-949DOI: (10.1016/j.molcel.2011.07.023) Copyright © 2011 Elsevier Inc. Terms and Conditions

Figure 6 Degradation of Mini yhxA-glpP RNA by Purified RNase J (A) Degradation of 5′ end-labeled monophosphorylated and triphosphorylated mini yhxA-glpP RNA by RNase J (an equimolar mixture of the J1 and J2 subunits). Reaction samples were quenched at time intervals and analyzed by electrophoresis beside radiolabeled ATP, radiolabeled AMP, and a 60 min mini yhxA-glpP RNA sample to which no RNase J had been added (Mock). (B) Rates of exonucleolytic and endonucleolytic degradation by RNase J. For each lane of panel A, the percentage of the total radioactivity that corresponded to exonucleolytic products (mononucleotides) or endonucleolytic products (oligonucleotides) was plotted as a function of time after correcting for any such products already present at time 0. See also Figure S5. Molecular Cell 2011 43, 940-949DOI: (10.1016/j.molcel.2011.07.023) Copyright © 2011 Elsevier Inc. Terms and Conditions

Figure 7 Mechanism of a 5′ End-Dependent Pathway for RNA Degradation in B. subtilis BsRppH (hatchet) removes the γ and β phosphates from the 5′ end of a triphosphorylated primary transcript, either simultaneously or sequentially. Once deprotected in this manner, the monophosphorylated decay intermediate is rapidly degraded by the 5′ exonuclease activity of the J1 subunit of RNase J (Pac-Man). Molecular Cell 2011 43, 940-949DOI: (10.1016/j.molcel.2011.07.023) Copyright © 2011 Elsevier Inc. Terms and Conditions