Bone morphogenetic protein-2 induces apoptosis in human myeloma cells with modulation of STAT3 by Chiharu Kawamura, Masahiro Kizaki, Kenji Yamato, Hideo Uchida, Yumi Fukuchi, Yutaka Hattori, Takeyoshi Koseki, Tatsuji Nishihara, and Yasuo Ikeda Blood Volume 96(6):2005-2011 September 15, 2000 ©2000 by American Society of Hematology

Morphological changes characteristic of apoptosis, and time-dependent effects of BMP-2 on cellular proliferation.U266 cells and HS-Sultan cells were treated with BMP-2 (50 ng/mL) for 48 hours and 72 hours, respectively. Morphological changes characteristic of apoptosis, and time-dependent effects of BMP-2 on cellular proliferation.U266 cells and HS-Sultan cells were treated with BMP-2 (50 ng/mL) for 48 hours and 72 hours, respectively. Cytospin slides were prepared and stained with Giemsa. Original magnification, ×1000. Cell viability was measured by MTT assay as compared with control cells cultured without BMP-2. Chiharu Kawamura et al. Blood 2000;96:2005-2011 ©2000 by American Society of Hematology

Effects of BMP-2 on cellular proliferation of various human myeloma cell lines.Myeloma cells were cultured with 50 ng/mL of BMP-2 for 48 hours, and cell viability was measured by MTT assay as compared with control cells cultured without BMP-2. Effects of BMP-2 on cellular proliferation of various human myeloma cell lines.Myeloma cells were cultured with 50 ng/mL of BMP-2 for 48 hours, and cell viability was measured by MTT assay as compared with control cells cultured without BMP-2. Results are expressed as the mean ± SD of at least 3 different experiments. *HS-Sultan cells were cultured for 72 hours. Chiharu Kawamura et al. Blood 2000;96:2005-2011 ©2000 by American Society of Hematology

BMP-2–induced apoptosis of U266 cells BMP-2–induced apoptosis of U266 cells.Agarose gel electrophoresis of DNA extracted from U266 cells treated with 50 ng/mL BMP-2 for 48 hours. BMP-2–induced apoptosis of U266 cells.Agarose gel electrophoresis of DNA extracted from U266 cells treated with 50 ng/mL BMP-2 for 48 hours. A 123–base pair DNA ladder was used as a molecular marker. DNA was detected as ultraviolet fluorescence after ethidium bromide staining. Chiharu Kawamura et al. Blood 2000;96:2005-2011 ©2000 by American Society of Hematology

Cell-cycle analysis of U266 cells cultured with BMP-2 Cell-cycle analysis of U266 cells cultured with BMP-2.U266 cells were cultured in the absence or presence of 50 ng/mL of BMP-2 for 0, 4, 24, and 48 hours and then stained with propidium iodide. Cell-cycle analysis of U266 cells cultured with BMP-2.U266 cells were cultured in the absence or presence of 50 ng/mL of BMP-2 for 0, 4, 24, and 48 hours and then stained with propidium iodide. DNA content was analyzed by means of flow cytometry. G1, S, and G2/M indicate cell phases. Apo indicates apoptotic cells. Chiharu Kawamura et al. Blood 2000;96:2005-2011 ©2000 by American Society of Hematology

Western blot analysis of the cell-cycle–associated proteins Rb, p21 CIP1/WAF1 , p27 KIP1 , CDK2, CDK4, cyclin D1, cyclin D2, cyclin D3, cyclin E, and p15 INK4 .Total cellular proteins (15 μg/lane) were separated on 12.5% SDS-polyacrylamide gels and transfor... Western blot analysis of the cell-cycle–associated proteins Rb, p21 CIP1/WAF1 , p27 KIP1 , CDK2, CDK4, cyclin D1, cyclin D2, cyclin D3, cyclin E, and p15 INK4 .Total cellular proteins (15 μg/lane) were separated on 12.5% SDS-polyacrylamide gels and transformed to the membrane. For the analysis of Rb, 7.5% gels were used. Protein levels were detected by means of Western blotting with antibodies directed against each protein. pRb indicates hypophosphorylated Rb; ppRb, hyperphosphorylated Rb. Blots were stained with Coomassie brilliant blue to confirm that equal amounts of protein were present in each lane. Chiharu Kawamura et al. Blood 2000;96:2005-2011 ©2000 by American Society of Hematology

Western blot analysis of the apoptosis-associated proteins Bcl-xL, Bad, and Bax.Cell lysates (15 μg protein per lane) were fractionated on 12.5% SDS-polyacrylamide gels and analyzed by Western blotting with antibodies directed against each protein. Western blot analysis of the apoptosis-associated proteins Bcl-xL, Bad, and Bax.Cell lysates (15 μg protein per lane) were fractionated on 12.5% SDS-polyacrylamide gels and analyzed by Western blotting with antibodies directed against each protein. Chiharu Kawamura et al. Blood 2000;96:2005-2011 ©2000 by American Society of Hematology

Activated STAT3 in U266 cells is decreased by treatment with BMP-2 Activated STAT3 in U266 cells is decreased by treatment with BMP-2.U266 cells were cultured with 50 ng/mL BMP-2 for the indicated times and examined for levels of tyrosine-phosphorylated (P-tyr) STAT3 by means of immunoblotting with antiphosphotyrosine anti... Activated STAT3 in U266 cells is decreased by treatment with BMP-2.U266 cells were cultured with 50 ng/mL BMP-2 for the indicated times and examined for levels of tyrosine-phosphorylated (P-tyr) STAT3 by means of immunoblotting with antiphosphotyrosine antibody (upper panel). The same blot was reprobed with anti-STAT3 antibody and confirmed to contain an equal amount of protein extract on each lane (lower panel). Chiharu Kawamura et al. Blood 2000;96:2005-2011 ©2000 by American Society of Hematology

Down-regulation of in vitro DNA-binding activity of STAT3 by BMP-2 Down-regulation of in vitro DNA-binding activity of STAT3 by BMP-2.EMSA using untreated U266 nuclear extracts (lane 1) and a radiolabeled STAT3 wild-type probe (GATCCGACATTTCCCGTAAATCG) generated DNA-protein complexes (arrows, lane 2), which were eliminated... Down-regulation of in vitro DNA-binding activity of STAT3 by BMP-2.EMSA using untreated U266 nuclear extracts (lane 1) and a radiolabeled STAT3 wild-type probe (GATCCGACATTTCCCGTAAATCG) generated DNA-protein complexes (arrows, lane 2), which were eliminated by a 100-fold molar excess of self-competitor (lane 5), but not by the same molar excess of the mutant STAT3 oligonucleotide that lacks the STAT binding site (lane 6). A similar sequence-specific DNA-binding activity was seen with the use of nuclear extracts from U266 cells treated with BMP-2 for 120 minutes (lanes 7-8). Supershift assays using the radiolabeled STAT3 probe, untreated or BMP-2–treated nuclear extract, and an anti-STAT3 polyclonal antibody eliminated cells that had been treated with a slowly migrating complex (indicated by the asterisk) (lanes 9-10). The uppermost DNA-protein complexes generated by nuclear extract prepared with BMP-2 for either 30 minutes or 120 minutes (lanes 3 and 4, respectively) were lower in intensity compared with those from untreated nuclear extract. The position of the free probe is indicated at the bottom of the gels. Chiharu Kawamura et al. Blood 2000;96:2005-2011 ©2000 by American Society of Hematology