CHROMOSOME FUSION?.

Slides:



Advertisements
Similar presentations
Time to Abandon Darwin? Answering the Challenge from design Kenneth R. Miller Brown University.
Advertisements

Genome Organisation II Eukaryotic genomes are completely different in their organisation compared to prokaryotic, and also much bigger Their genes are.
Mystery of the Matching Marks 2 DO I HAVE YOUR ATTENTION? For some reason, a GUNSHOT seems to suggest a CRIME SCENE… with BULLETS … and BULLET MARKS.
Mystery of the Matching Marks (Part 3) 2 DNA Search Lab Followup Welcome back from your SEARCH FOR THE TELL-TALE TELOMERE Let’s see what it tells us…
Weighing the Evidence Today we will try to assess whether humans and chimpanzees share a common ancestor NEW CORE CURRICULUM: FOUNDATIONS OF THE SCIENTIFIC.
Chromosomes and Diseases Genetics MBG-210. How many chromosomes in humans? Theophilus Painter in 1921 characterized the number of chromosomes as 24 on.
CHROMOSOME FUSION?. WHAT IS MOST STRIKING HERE? Compare the Banding Patterns: 6 longest chromosomes of humans (Hu), are matched with 7 chromosomes from.
Mystery of the Matching Marks part 2. Let’s look at our two sets of chromosomes again, side-by-side. This time, Focus on their DIFFERENCES: What do you.
Evidence of Evolution by Natural Selection
More Historical Evidence The study of Homologies.
Evolution: Fact and Theory  Fact: Species change over time.  Theory: Species arise from common descent through natural selection  Random mutations lead.
Regents Biology Witness to Evolution. Regents Biology Witness to Evolution  Peppered Moth  2 types: dark vs. light Peppered moth light.
AP Biology Evidence of Evolution by Natural Selection Testable Hypotheses.
AP Biology Evidence of Evolution by Natural Selection Testable Hypotheses.
Does The Evidence Support Evolution? “More than a century ago, Darwin and Huxley posited that humans share recent common ancestors with the African great.
Evidence for Evolution
Mystery of the Matching Marks DO I HAVE YOUR ATTENTION? For some reason, a GUNSHOT seems to suggest a CRIME SCENE… with BULLETS … and BULLET MARKS.
Lesson 4-5 LCM: Least Common Multiple. Multiples A multiple is formed by multiplying a given number by the counting numbers. The counting numbers are.
Are We Really Related to Chimps?
How Do Traits Get Passed On? LESSON 4. Move to which corner you think is correct for each question Can offspring get instructions for the variation of.
Evolution is the process of biological change by which descendants come to differ from their ancestors.
DNA Questions What makes up a DNA backbone? How would you describe how DNA looks? Name the 4 bases that make up DNA. “T” base can only match with? What.
Mystery of the Matching Marks 2  For some reason, a GUNSHOT seems to suggest a CRIME SCENE… DO I HAVE YOUR ATTENTION? with BULLETS … and BULLET MARKS.
Looking Within Human Genome King abdulaziz university Dr. Nisreen R Tashkandy GENOMICS ; THE PIG PICTURE.
Human and Ape DNA Lab.
Mind Stretcher 2/14/17: What are these items used for?
In the last two lessons, you examined several patterns
Evidence of Evolution by Natural Selection
Evidence of Evolution by Natural Selection
Evidence of Evolution by Natural Selection
Evidence of Evolution by Natural Selection
Does The Evidence Support Evolution?
Example of a common SNP in dogs
Genomes and Their Evolution
Evidence of Evolution by Natural Selection
Patterns with Multiples
Mystery of the Matching Marks part 2.
WHAT IS EVOLUTION?.
Evidence of Evolution by Natural Selection
Mystery of the Matching Marks.
CHROMOSOME CONNECTION
One-Gene-One-Enzyme, Pseudogenes & Common Ancestry
November 5, 2013 Signed interims should be placed in the IN BOX
CHROMOSOME COMPARISONS
CLADISTICS Cladistic relationships are shown in a diagram called a_________________ CLADOGRAM Image from:
Does evolution occur in rapid bursts or gradually (over time)?
Lesson 3 Thursday, 11/14 AIM: What is a telomere?
CHROMOSOME COMPARISONS
Year 2 (National Numeracy Strategy) (Based on DFEE Sample Lessons)
Evidence of Evolution by Natural Selection
Evidence of Evolution by Natural Selection
Gradualism, Punctuated Equilibrium
CHROMOSOME FUSION?.
CHROMOSOME COMPARISONS
What is allele frequency?
Evidence of Evolution by Natural Selection
Gradualism, Punctuated Equilibrium
Year 2 (National Numeracy Strategy) (Based on DFEE Sample Lessons)
Gradualism, Punctuated Equilibrium
Sexual Reproduction and Genetic Variation
What Can Our Chromosomes Tell Us?
Witness to Evolution
4. _____________________
Evidence of Evolution by Natural Selection
Meiosis and Sexual Reproduction
Multiples and Factors Lesson 2.2.
Mystery of the Matching Marks part 2.
Evidence of Evolution by Natural Selection
Presentation transcript:

CHROMOSOME FUSION?

WHAT IS MOST STRIKING HERE? Compare the Banding Patterns: 6 longest chromosomes of humans (Hu), are matched with 7 chromosomes from three ape species.

Why are the chromosome tips colored? WHY COLORED TIPS? Why are the chromosome tips colored?

CHROMOSOME PARTS Head Telomere All Chromosomes have telomeres at their ends (like shoelace aglets!) Centromere Tail Telomere Telomeres have a unique DNA sequence… ttagggttagggttagggttagggttagggttaggg… |||||||||||||||||||||||||||||||||||| aatcccaatcccaatcccaatcccaatcccaatccc…

Let’s Narrow Our Focus: 6 longest chromosomes of humans (Hu), matched with 7 chromosomes from chimpanzees ONLY (Ch)

MORE QUESTIONS… Why are TWO shorter chimp chromosomes needed to match our #2 chromosome? Could our #2 chromosome have formed by the FUSION of TWO shorter chromosomes found in chimpanzees today (#12 and #13)? LIKE THIS…?

Human #2 Chimp #13 Chimp #12

PREDICTION Chimp #13 If fusion occurred, then we should see DNA evidence of the head-to-head telomeres together near middle of our #2 chromosome Human #2 Chimp #12 Fusion Area?

DNA Head Telomere DNA Sequence for Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Centromere NOTICE: Tandem Repeats in Telomeres: ttagggttagggttaggg… |||||||||||||||||| aatcccaatcccaatccc… Repeated 800-1600 times in each Telomere Tail Telomere

EXPECTATIONS What will you look for? tandem repeats in fusion area Where will you look for them? middle of our chromosome #2 How can you look for them? search online DNA database What if evidence is NOT found? fusion may not have happened

Do the lesson - Go online CHROMOSOME FUSION Read the lesson Do the lesson - Go online Discuss the results Explanation? STOP HERE CONTINUE ONLY AFTER DOING LESSON or if there’s no time to do the lesson

STOP HERE (Results follow)

RESULTS 108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

RESULTS CLARIFIED HEAD 13 HEAD 12 108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg HEAD 13 HEAD 12 See where the head-to-head fusion occurred?

DO THE LESSON, and find out! WHY THE SUDDEN CHANGE? 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta HEAD 13 HEAD 12 Why do the TANDEM REPEATS suddenly change from ttaggg to ccctaa? Why so many slight variations in the number of t’s, a’s, g’s, and c’s in each repeat? DO THE LESSON, and find out!

WHY SO FEW REPEATS? 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg HEAD 13 HEAD 12 Count the TANDEM REPEATS in both telomere segments. (only about 37 ttaggg repeats in Head 13; about 88 ccctaa repeats in Head 12) Should be 800 to 1600 repeats, so… Why so many FEWER than typically found in telomeres? DO THE LESSON and find out!

Further Confirmation Comparison of DNA in Our Chrom. #2 with...

Another Confirmation Comparison of DNA in Our Chrom. #3 with...

Re-Check Banding Patterns Compare other chromosomes online: Human with Chimp, Dog…

MULTIPLE EVIDENCE DO THE LABS! Compare hominoid chromosomes Compare hominoid skulls Study pattern of hominid chronology Compare primate hemoglobins What do ALL of these patterns suggest? DO THE LABS!