Inside the Nucleus of a Cell…

Slides:

Advertisements

Similar presentations

Do Now:.  TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA,

Advertisements

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

RNA and Protein Synthesis

RNA and Protein Synthesis. DNA to RNA to Protein Focus Questions: –How does the message coded in the base sequence of DNA eventually create a protein?

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

VII RNA and Protein Synthesis

Chapter 13: RNA and Protein Synthesis

Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.

The Genetic Code.

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (__________) codes for a particular.

Notes: Protein Synthesis

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

12-3 RNA and Protein Synthesis

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (GENE) codes for a particular protein;

Protein Synthesis. Steps: TRANSCRIPTION DNA unwinds, RNA is made from DNA DNA acts as a template for RNA.

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

Do Now: On the “Modeling DNA Transcription & Translation” handout, figure out the compimentary DNA sequence AND the mRNA sequence.

Transcription and Translation How genes are expressed (a.k.a. How proteins are made) Biology.

Decoding the message. DNA and RNA work together to produce proteins Remember: A protein is a specific sequence of amino acids.

Protein Synthesis: Transcription & Translation.

Copyright © by Holt, Rinehart and Winston. All rights reserved. ResourcesChapter menu Flow of Genetic Information The flow of genetic information can be.

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?

The Central Theme of Molecular Biology is Protein Synthesis Step I: Going from DNA to RNA called Transcription Step II: Going from RNA to Protein called.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

RNA. RNA RNA: Ribonucleic Acid. Takes info in DNA to create proteins DNA RNA PROTEIN.

Notes: Transcription DNA vs. RNA

HOW PROTEINS ARE MADE BY THE CELL

Ribosomes and Protein Synthesis

CH 12.3 RNA & Protein Synthesis.

Translation mRNA  protein.

Gene Expression Continued

The making of proteins for …..

RNA Another Nucleic Acid.

RNA and Protein Synthesis

RNA and Protein Synthesis

Protein Synthesis Standards:

Protein Synthesis.

Protein Synthesis.

Protein Synthesis.

Old News TRANSCRIPTION: process that makes an _______ ___________ of DNA. RNA is ________________, and ___ is replaced by ___ (A-U; G-C) RNA___________________.

DNA transcribes RNA RNA translates to protein

Chp: 12 Transcription & Translation

Transcription & Translation.

TRANSCRIPTION FLOWCHART

Amino Acid Activation And Translation.

Transcription -The main purpose of transcription is to create RNA from DNA because RNA leaves the nucleus to carry out its functions but DNA does not -A.

Transcription and Translation

Players in the protein game

Protein Synthesis Step 2: Translation

Translation (Protein Synthesis) RNA  protein.

5-5 NOTES: TRANSLATION RNA  PROTEIN

Protein Synthesis Lecture 5

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

RNA and Protein Synthesis

RNA - TRANSLATION.

Translation and Transcription

Translation Decoding the message.

GENE EXPRESSION / PROTEIN SYNTHESIS

DNA -> RNA -> Proteins

Continuation: translation

DNA & Gene Expression Transcription & Translation

Protein Synthesis.

Protein Synthesis.

Protein Synthesis.

3 July 2019 P. 56 Complete Quick Lab p. 303 Compare and contrast:

Transcription and translation

Presentation transcript:

Inside the Nucleus of a Cell… Enzyme: Click to Unwind DNA

this gene for transcription Enzyme: Click to split this gene for transcription

Type the letter of the mRNA base to transcribe the strand Type the letter of the mRNA base to transcribe the strand. Then click submit Move to Ribosome

tRNA carrying amino acids mRNA Start U anticodon U codon glycine U U proline U Define codon and anticodon in your notebook 2. Include a memory cue.. mRNA takes DNA’s message to the ribosome.

tRNA uses mRNA template to assemble amino acids into a protein. Start U This process is Known as Translation. Using this slide and the next, summarize translation on your organizer. U glycine U U proline U tRNA uses mRNA template to assemble amino acids into a protein.

RNA can be reused. Start glycine proline Growing peptide chain (eventually becomes a protein) Amino acids will keep being added according to the instructions until a stop code is reached.

DNA Strand: TACGCGGAGACT Transcribe the mRNA and click submit Using the DNA strand below, transcribe and translate the gene to determine the protein that will be made. Please use all caps. DNA Strand: TACGCGGAGACT Transcribe the mRNA and click submit Use the codons to find the amino acids in the chart below. List amino acid abbreviations in all caps with one space between them. Then click submit.