Changes in the nucleotide sequence of DNA or mRNA

Slides:



Advertisements
Similar presentations
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring, only to descendant cells)
Advertisements

Mutations 1.
Transcription, Translation Review. Mutations and Genetic Modifications.
Unit 4 Part 1.  DNA cannot leave the nucleus.  Through transcription an mRNA copy of DNA is made.  RNA Polymerase unwinds and unzips the DNA.  RNA.
DNA Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA.
Biology – 9 th Grade Chapter 10.  Environmental Influences such as: Chemicals or UV Rays  Inherited: mutations can be passed down from parent to offspring.
Mutations. What Are Mutations?  Changes in the nucleotide sequence of DNA  May occur in somatic cells (aren’t passed to offspring)  May occur in gametes.
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
Biology – 9 th Grade Chapter 10.  Environmental Influences such as: Chemicals or UV Rays  Inherited: mutations can be passed down from parent to offspring.
To demonstrate understanding, after this lesson, you should be able to  define mutations  explain how mutations occur when – DNA Replication or Meiosis.
REVIEW. Protein Synthesis AT-A-GLANCE Translation.
Ch Mutations Section Objectives:
DNA Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA.
NOTES – CH 17, part 2 DNA & MUTATIONS
Biology I Brandon High School
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.
Ch Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations.
DNA Mutations. Remember that during DNA replication, the DNA makes an exact copy of itself before it divides. DNA replication is not always accurate.
Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.
Mutations. What Are Mutations? MUTATION = A change in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur.
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
Mutations.
Don’t let this happen to you!!
Mutation Notes: Chapter 11.
Do Now: What is a gene? A sequence of nucleotides
Mutations.
Copyright Pearson Prentice Hall
Mutations and Nature vs. Nurture.
Mutations.
Mutations.
Mutations.
Mutations.
Mutations.
Mutations and Genetic Disorders
Mutations.
Copyright Pearson Prentice Hall
DNA Mutations & Disorders
MUTATIONS.
Chromosomes, Genes, Alleles and Mutations
Genetic Mutations.
13.3_Mutations SC.912.L.16.4 Explain how mutations in DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result.
Mutations. Mutations Mutation A permanent, heritable change in the DNA of an organism. One or several nucleotides can be added, deleted, or replaced.
Mutations.
GOOD? BAD? NO EFFECT? MUTATIONS.
Types of point mutations
To be successful today…
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
Mutations.
Mutations Section 12-4.
Mutations.
Mutations.
Mutations A mutation is any change in the DNA sequence.
Ch 12-4 Genetic Mutations.
MUTATIONS.
MUTATIONS.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutations.
Mutation Three CAUSES: Definition: Is a permanent change in DNA.
Mutations A mutation is any change in the DNA sequence.
Draw a conclusion from this graph for both the red and blue line
MUTATIONS.
Mutations.
Mutations.
13.3 Mutations.
Mutations.
Mutations: Changes in Genes
Presentation transcript:

Changes in the nucleotide sequence of DNA or mRNA Mutations Changes in the nucleotide sequence of DNA or mRNA

Mutations Changes in the nucleotide sequence of DNA or RNA that code for a protein Mutations are caused by mutagens (means “to generate a mutation”) Examples: UV Radiation Cigarette Smoke Viruses Chemicals: Laboratory, pesticides, insecticides

Point Mutations One nucleotide base is replaced with another (A single nucleotide mutates thus affecting one codon.) It’s like changing one “word” in a DNA sentence.

Silent Point Mutation For Example This is a harmless mutation. Since many amino acids have multiple codons, it is possible that a mutated codon will still translate into a correct amino acid. For Example Original Sequence: G A A  G A G mRNA: C U U  C U C Amino Acids: Leu  Leu

Missense Point Mutation This mutation changes the amino acid coded for (MIStake). This is seen in the mutation that causes Sickle Cell Anemia For Example Original Sequence: C T T  C A T mRNA: G A A  G U A Amino Acids: Glu  Val Glutamate Or glutamic acid becomes Valine

Sickle Cell Anemia

Frameshift Mutations These mutations alter the codon sequence and shift the ‘reading frame’ (A reading frame is a set of 3 consecutive nucleotides (codon) read in the 5’  3’ direction). It’s like changing the DNA “sentence.” Frameshift mutations are normally very serious. If the codons aren’t read correctly, they will be translated into incorrect amino acids and make nonfunctional proteins.

Insertion: adding nucleotides to the sequence Original sequence: THE BIG TAN DOG RAN Original with Insertion: THE BOI GTA NDO GRA N For Example Original Sequence: CAT TGA  CAT ATG A mRNA codons: GUA ACU  GUA UAC U Amino Acids: Val Thr  Val Tyr --

Deletion: taking nucleotides out of the sequence Original sequence: THE BIG TAN DOG RAN Original with Deletion: THE BGT AND OGR AN For Example: Original Sequence: CAT TGA  CTT GA mRNA codons: GUA ACU  GAA CU Amino Acids: Val Thr  Glu --

Chromosomal Mutations Mutations in chromosome structure Deletion: sections of the chromosome are missing Duplication: sections of a chromosome are repeated

Mutations in Chromosome Number Monosomy: only one copy of a chromosome Turner Syndrome: when a female has only one X chromosome. Females with this condition have short stature, are sterile and have other physical abnormalities.

Trisomy: one extra copy of a particular chromosome (three copies total) Down Syndrome (trisomy 21): mental retardation, short stature, wide set eyes Occurs in about 1 in 691. Most individuals live to adulthood, but may have shorter lifespan than average

Who is Affected? Somatic Cells Gametes If a mutation happens in a body cell, only the person that the mutation occurred to will be affected Mutations in body cells can lead to cancer Gametes If a mutation happens in a sex cell, only the organism created from that sex cell will be affected. Mutations in sex cells affect future generations and this is a cause of evolution, i.e. change in DNA over time