Isaiah 40:28 28 Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth, fainteth not, neither is weary? there is no searching of his understanding.

Replication Timothy G. Standish, Ph. D.

The Information Catch-22 “With only poor copying fidelity, a primitive system could carry little genetic information without L [the mutation rate] becoming unbearably large, and how a primitive system could then improve its fidelity and also evolve into a sexual system with crossover beggars the imagination.” Hoyle F. 1987. "Mathematics of Evolution", Acorn Enterprises: Memphis TN, 1999, p20

Tools of Replication Enzymes are the tools of replication: DNA Polymerase - Matches the correct nucleotides then joins adjacent nucleotides to each other Primase - Provides an RNA primer to start polymerization Ligase - Joins adjacent DNA strands together (fixes “nicks”)

More Tools of Replication Helicase - Unwinds the DNA and melts it Single-Strand Binding Proteins - Keep the DNA single stranded after it has been melted by helicase Gyrase - A topisomerase that relieves torsional strain in the DNA molecule Telomerase - Finishes off the ends of DNA strands

Extension - The Replication Fork 5’ 3’ Primase - Makes RNA primers Single-strand binding proteins - Prevent DNA from re-anealing Lagging Strand 3’ 5’ 5’ 3’ Okazaki fragment RNA Primers DNA Polymerase Helicase - Melts DNA Gyrase - Relieves torsional strain Leading Strand 5’

Extension - Okazaki Fragments DNA Pol. 3’ 5’ RNA Primer Okazaki Fragment DNA Polymerase has 5’ to 3’ exonuclease activity. When it sees an RNA/DNA hybrid, it chops out the RNA and some DNA in the 5’ to 3’ direction. 3’ 5’ RNA Primer DNA Pol. RNA and DNA Fragments DNA Polymerase falls off leaving a nick. 3’ 5’ RNA Primer Ligase Nick The nick is removed when DNA ligase joins (ligates) the DNA fragments.

The Role of DNA Gyrase Helicase

The Role of DNA Gyrase Helicase Supercoiled DNA Gyrase

The Role of DNA Gyrase Gyrase

The Role of DNA Gyrase Gyrase

The Role of DNA Gyrase Gyrase

The Role of DNA Gyrase Gyrase

The Role of DNA Gyrase Gyrase

The Role of DNA Gyrase Gyrase

The Role of DNA Gyrase Gyrase

The Role of DNA Gyrase Gyrase

The Role of DNA Gyrase Gyrase

E. coli DNA Polymerases E. coli has three identified DNA polymerases each of which has significantly different physical characteristics and roles in the cell II III I Polymerase Yes 5’- 3’ Polymerization Yes 3’-5’ Exonuclease Yes No 5’-3’ Exonulcease 400 ? 15 Molecules/cell Major function Proofreading/ Removal of RNA primers 109,000 Daltons Repair of damaged DNA Replication polymerization 10 subunits 600,000 Daltons Klenow fragment (76,000 Daltons), prepared by mild proteolysis, lacks 5’ to 3’ exonuclease activity and is used in sequencing

Telomerase At the end of linear chromosomes the lagging strand can’t be completed as the last primer is removed and no 3’ hydroxyl group is available for DNA polymerase to extend from Telomere 3’ 5’ 3’ 5’ Degradation of RNA primer at the 5’ end 3’ 5’ Next replication 3’ 5’ +

Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length AACCCCAAC Telomerase RNA 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG GGGTTG

Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length AACCCCAAC Telomerase RNA 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG GGGTTG GGGTTG

Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length AACCCCAAC Telomerase RNA 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG GGGTTG GGGTTG GGGTTG

Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGGGTTGGGGTTGGGGTTG 3’CTGGCTCGG O N H Guanine O N H Guanine

Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing DNA Pol. 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG GGGGTTG T 3’CTGGCTCGG 3’GTTGGGG T

Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing DNA Pol. Endo- nuclease 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG T 3’CTGGCTCGG AGAACCCAACCCGTTGGGG T

Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGG 3’CTGGCTCGG AGAACCCAACCC GTTGGGG T Endo- nuclease

The End

Mutation When Mistakes Are Made 5’ DNA Pol. 5’ 3’ Mismatch 5’ DNA Pol. 5’ 3’ 3’ to 5’ Exonuclease activity DNA Pol. 5’ 3’

Mutation Excision Repair 3’ 5’ Endo- Nuclease Thimine Dimer 5’ 3’

Mutation Excision Repair 3’ 5’ Endo- Nuclease 5’ 3’ Nicks DNA Pol. 5’ 3’

Mutation Excision Repair 3’ 5’ Endo- Nuclease 5’ 3’ DNA Pol. 5’ 3’

Mutation Excision Repair 3’ 5’ Endo- Nuclease 5’ 3’ Nicks 5’ 3’ Ligase Ligase Nick DNA Pol.

O N H

DNA Replication: How We Know There are three ways in which DNA could be replicated: Old Conservative - Old double-stranded DNA serves as a template for two new strands which then join together, giving two old strands together and two new strands together Old Semi-conservative - Old strands serve as templates for new strands resulting in double-stranded DNA made of both old and new strands + Old New + New Old + Old + New + Old + New or Old Dispersive - In which sections of the old strands are dispersed in the new strands

The Meselson-Stahl Experiment The Meselson-Stahl experiment demonstrated that replication is semiconservative This experiment took advantage of the fact that nucleotide bases contain nitrogen Thus DNA contains nitrogen OH H P O HO NH2 N The most common form of Nitrogen is N14 with 7 protons and 7 neutrons N15 is called “heavy nitrogen” as it has 8 neutrons thus increasing its mass by 1 atomic mass unit

The Meselson-Stahl Experiment Transfer to normal N14 media Bacteria grown in N15 media for several replications After 20 min. (1 replication) transfer DNA to centrifuge tube and centrifuge Semiconservative model prediction Conservative model prediction Dispersive model prediction X The conservative and dispersive models make predictions that do not come true thus, buy deduction, the semiconservative model must be true. Prediction after 2 or more replications X X

The Current Eukaryotic Recombination Model Homologous chromosomes Meiosis Prophase I

The Current Eukaryotic Recombination Model Exo- nuclease Double strand break

The Current Eukaryotic Recombination Model Exo- nuclease

The Current Eukaryotic Recombination Model Exo- nuclease

The Current Eukaryotic Recombination Model Exo- nuclease

The Current Eukaryotic Recombination Model DNA Polymerase

The Current Eukaryotic Recombination Model DNA Polymerase

The Current Eukaryotic Recombination Model DNA Polymerase

The Current Eukaryotic Recombination Model DNA Polymerase

The Current Eukaryotic Recombination Model

Holliday Structure

Holliday Structure Bend

Holliday Structure Bend Twist

Holliday Structure Cut

Holliday Structure Cut

Holliday Structure Cut

Holliday Structure Cut

Holliday Structure

Cutting The Holliday Structure