Long-term exposure to high altitude hypoxia during pregnancy increases fetal heart susceptibility to ischemia/reperfusion injury and cardiac dysfunction

Slides:

Advertisements

Similar presentations

Online Resource 1. Article title: Depletion of circulating blood NOS3 increases severity of myocardial infarction and left ventricular dysfunction Journal.

Advertisements

Involvement of the Mitochondrial Calcium Uniporter in Cardioprotection by Ischemic Preconditioning.

Atttgaaatgaaggcagaaaccaggcttaaacaaagactgaaactcattctcttttcaaa tctcctgccgataaacatatgtgcccagtcttttgtttcccagacatcaggtttccatta tttaaacagagcttctacctggatctgtcaagagcatgaggcagacatatttaagatttt.

Journal of Molecular and Cellular Cardiology

Reduction of heart failure by pharmacological inhibition or gene deletion of protein tyrosine phosphatase 1B Elodie Gomez, Magali Vercauteren, Baptiste.

Cardioprotective Effect of a Hemoglobin-Based Oxygen Carrier on Cold Ischemia/Reperfusion Injury Cardiology 2011;120:73–83 - DOI: / Fig.

Fig. 2. Post-treatment with isoflurane reduced infarct volume

Molecular Therapy - Nucleic Acids

Chronic Hypoxia Suppresses Pregnancy-Induced Upregulation of Large-Conductance Ca2+-Activated K+ Channel Activity in Uterine ArteriesNovelty and Significance.

Chung S. Lim, MRCS, PhD, Serafim Kiriakidis, PhD, Ewa M

Myocardial protection with oxygenated esmolol cardioplegia during prolonged normothermic ischemia in the rat Ryuzo Bessho, MD, PhD, David J. Chambers,

Reduction of systolic and diastolic dysfunction by retrograde coronary sinus perfusion during off-pump coronary surgery Manuel Castellá, MD, Gerald D.

Chung S. Lim, MRCS, PhD, Serafim Kiriakidis, PhD, Ewa M

A novel peroxynitrite decomposer catalyst (FP-15) reduces myocardial infarct size in an in vivo peroxynitrite decomposer and acute ischemia-reperfusion.

Support with intra-aortic balloon pump vs. Impella2

High basal level of autophagy in high-altitude residents attenuates myocardial ischemia– reperfusion injury Yijie Hu, MD, Qi Sun, MD, Zhiping Li, MD,

Enteral supplementation of alanyl–glutamine attenuates the up-regulation of beta- defensin-2 protein in lung injury induced by intestinal ischemia reperfusion.

Failure of Preconditioning to Improve Postcardioplegia Stunning of Minimally Infarcted Hearts Bouchaib Faris, Jacqueline Peynet, Michel Wassef, Alain.

Volume 21, Issue 4, Pages (April 2015)

Repeated remote ischemic conditioning attenuates left ventricular remodeling via exosome-mediated intercellular communication on chronic heart failure.

Prolonged donor heart preservation with pinacidil: The role of mitochondria and the mitochondrial adenosine triphosphate–sensitive potassium channel

Molecular Therapy - Nucleic Acids

Cyclophosphamide protects against myocardial ischemia/reperfusion injury in rats: One of the therapeutic targets is high sensitivity C-reactive protein

Preconditioning protects the severely atherosclerotic mouse heart

Isoflurane-induced myocardial preconditioning is dependent on phosphatidylinositol-3- kinase/Akt signalling J. Raphael, J. Rivo, Y. Gozal British Journal.

Denis D. Damasceno, Anderson J. Ferreira, Maria C. Doretto, Alvair P

Cytokines Link Toll-Like Receptor 4 Signaling to Cardiac Dysfunction After Global Myocardial Ischemia John Cha, MD, Zhiping Wang, MD, Lihua Ao, BS, Ning.

Molecular Therapy - Nucleic Acids

Cyclin dependent kinase inhibitor 1 C is a female-specific marker of left ventricular function after acute myocardial infarction Torkia Lalem, Lu Zhang,

L. Tong, M. Cai, Y. Huang, H. Zhang, B. Su, Z. Li, H. Dong

Heike A. Hildebrandt et al. BTS 2016;1:3-13

Blockade of Inflammation and Apoptosis Pathways by siRNA Prolongs Cold Preservation Time and Protects Donor Hearts in a Porcine Model Jia Wei, Shiyou.

Proteasome Inhibition Attenuates Infarct Size and Preserves Cardiac Function in a Murine Model of Myocardial Ischemia-Reperfusion Injury William E. Stansfield,

Stefano Toldo et al. BTS 2017;2:

Hirotsugu Hamamoto, MD, Bradley G. Leshnower, MD, Landi M

FGL2 prothrombinase contributes to the early stage of coronary microvascular obstruction through a fibrin-dependent pathway Wen-Zhu Li, Yi Yang, Kun.

Endothelial microparticles exert differential effects on functions of Th1 in patients with acute coronary syndrome Yongguang Lu, Lang Li, Hua Yan, Qiang.

Marinus A. Borgdorff, Beatrijs Bartelds, Michael G

D. Ebel, P. Lipfert, J. FraÕßdorf, B. Preckel, J. MuÕllenheim, V

Potent adenylate cyclase agonist forskolin restores myoprotective effects of ischemic preconditioning in rat hearts after myocardial infarction Shigetoshi.

M2b macrophages reduce early reperfusion injury after myocardial ischemia in mice: A predominant role of inhibiting apoptosis via A20 Yuan Yue, Xiao.

Efficient gene transfer method into the whole heart through the coronary artery with hemagglutinating virus of Japan liposome Yoshiki Sawa, MDa, Keishi.

Effects of cardioplegia on vascular function and the “no-reflow" phenomenon after ischemia and reperfusion: Studies in the isolated blood-perfused rat.

Normokalemic adenosine–lidocaine cardioplegia: Importance of maintaining a polarized myocardium for optimal arrest and reanimation Kathryn L. Sloots,

Volume 24, Issue 1, Pages (July 2016)

Kourosh Baghelai, MDa, Laura J. Graham, BSa, Andrew S

Courtney N. Zeller, Yue Wang, PhD, Troy A

Brian R. Weil et al. BTS 2017;2: Experimental Protocol (A) Following baseline data collection, the left anterior descending coronary artery was.

Bradykinin pretreatment improves ischemia tolerance of the rabbit heart by tyrosine kinase mediated pathways Jun Feng, MD, PhD, Eliot R Rosenkranz, MD

Expression of vascular endothelial growth factor and its receptors is increased, but microvascular relaxation is impaired in patients after acute myocardial.

Beneficial effect of tetrahydrobiopterin on ischemia-reperfusion injury in isolated perfused rat hearts Satoshi Yamashiro, MDa,b, Katsuhiko Noguchi,

Induction of the expression of cardioprotective proteins after mild-to-moderate consumption of alcohol Motoaki Sato, Cesar Fraga, Dipak K. Das Pathophysiology

Maike Krenz, Michael V. Cohen, James M. Downey Pathophysiology

Controlled hyperkalemic reperfusion with magnesium rescues ischemic juvenile hearts by reducing calcium loading Hajime Imura, MD, Hua Lin, MSc, Elinor.

Pulse pressure for selecting the optimal cardiac strategy in patients with type 2 diabetes and coronary artery disease Tetsuro Tsujimoto, Hiroshi Kajio

Elucidation of a tripartite mechanism underlying the improvement in cardiac tolerance to ischemia by coenzyme Q10 pretreatment Juan A. Crestanello, MD.

Experimental study of intermittent crossclamping with fibrillation and myocardial protection: Reduced injury from shorter cumulative ischemia or intrinsic.

Three-dimensional echocardiographic diagnosis of a giant congenital diverticulum of the left ventricular outflow tract Jiani Liu, Xiaoling Zhang, Xi.

‘The sedentary heart’: Physical inactivity is associated with cardiac atrophy in adults with an intellectual disability Jeroen C. Vis, Rianne H. de Bruin-Bon,

Optimizing flecainide plasma concentration profile for atrial fibrillation conversion while minimizing adverse ventricular effects by rapid, low-dose.

Shankha S Biswas, Edward P Chen, Hartmuth B Bittner, R

Volume 19, Issue 4, Pages (April 2011)

Association of sustained cardiovascular recovery with epinephrine in the delayed lipid- based resuscitation from cardiac arrest induced by bupivacaine.

Reactive hyperemia during early reperfusion as a determinant of improved functional recovery in ischemic preconditioned rat hearts Annie Rochetaing,

Molecular Therapy - Nucleic Acids

Volume 24, Issue 2, Pages (February 2016)

Suprarenal aortic clamping and reperfusion decreases medullary and cortical blood flow by decreased endogenous renal nitric oxide and PGE2 synthesis

Integrated pharmacological preconditioning in combination with adenosine, a mitochondrial KATP channel opener and a nitric oxide donor Yuka Uchiyama,

Early effects of hypothyroidism on the contractile function of the rat heart and its tolerance to hypothermic ischemia Manuel Galiñanes, MD, PhD, Ryszard.

Cardioprotection by sevoflurane against reperfusion injury after cardioplegic arrest in the rat is independent of three types of cardioplegia D. Ebel,

Presentation transcript:

Long-term exposure to high altitude hypoxia during pregnancy increases fetal heart susceptibility to ischemia/reperfusion injury and cardiac dysfunction Peng Zhang, Jun Ke, Yong Li, Lei Huang, Zewen Chen, Xiaohui Huang, Lubo Zhang, Daliao Xiao International Journal of Cardiology Volume 274, Pages 7-15 (January 2019) DOI: 10.1016/j.ijcard.2018.07.046 Copyright © 2018 Elsevier B.V. Terms and Conditions

Fig. 1 Effect of HAH on post ischemic recovery of LV function in both male and female fetuses. Hearts were isolated from the male and female fetuses. The hearts were subjected to 20 min of ischemia and 60 min of reperfusion in a Langendorff preparation. Post-ischemic recoveries of the left ventricular diastolic pressures (LVDP) in male (A) and female (E). dP/dpmax in male (B) and female (F). dP/dpmin in male (C) and female (G). Heart rate in male (D) and female (H). Data are means ± SEM of animals from each group. Data were analyzed by 2-way repeated measures ANOVA (*P < 0.05 vs. control group). Then, compare the two group at every time point using multiple t-test comparison (#P < 0.05 vs. control at each time point). International Journal of Cardiology 2019 274, 7-15DOI: (10.1016/j.ijcard.2018.07.046) Copyright © 2018 Elsevier B.V. Terms and Conditions

Fig. 2 Effect of HAH on I/R-induced coronary flow rate (CF), LVEDP and myocardial infarction in both male and female fetuses. Hearts were isolated from the male and female fetuses. The hearts were subjected to 20 min of ischemia and 60 min of reperfusion in a Langendorff preparation. During ischemia/reperfusion (I/R), the pulmonary artery effluent was collected from both male (A) and female (D) as an index of coronary flow (milliliters per minute per gram of heart wet weigh). Post-ischemic recovery of the left ventricular end-diastolic pressures (LVEDP) was determined during the course of reperfusion in both male (B) and female (E) fetuses. The left ventricular tissue were collected from both male (C) and female (F) fetuses at the end of reperfusion, and the myocardial infarct size was determined with 1% triphenyltetrazolium chloride (TTC) staining and expressed as a percentage of the total ventricular weight. Data are means ± SEM of animals from each group. Data for CF and LEVDP were analyzed with 2-way repeated measures ANOVA (*P < 0.05 vs. control group). Then, compare the two group at every time point using multiple t-test comparison (#P < 0.05 vs. control at each time point). Data for infarct size were analyzed by Student t-test. *P < 0.05 vs. control (normoxia). International Journal of Cardiology 2019 274, 7-15DOI: (10.1016/j.ijcard.2018.07.046) Copyright © 2018 Elsevier B.V. Terms and Conditions

Fig. 3 HAH-mediated changes of hypoxic biomarkers and protein expressions. Heart were isolated from fetuses from near-term pregnant sheep maintained at sea level (control) or exposed to high altitude hypoxia (HAH). Protein abundances in the left ventricle (LV) tissues were determined by Western blot analyses. The protein levels of HIF-1α in male (A) and female (E) LV tissues. The protein levels of DNMT3b in male (C) and female (G) LV tissues. The protein levels of PKCε in male (D) and female (H) LV tissues. The protein levels are expressed as fold of GAPDH (loading control). MiRNA-210 levels in the LV tissues isolated from male (B) and female (F) fetuses were measured by qRT-PCR analysis, as described under Material and methods. The expression of miR-210 is expressed as percentage of SNORD61 (internal control). Data are means ± SEM of animals from each group and were analyzed by Student t-test. *P < 0.05 vs. control (normoxia). International Journal of Cardiology 2019 274, 7-15DOI: (10.1016/j.ijcard.2018.07.046) Copyright © 2018 Elsevier B.V. Terms and Conditions

Fig. 4 Effect of HAH on autophagy-related protein expressions. Heart were isolated from fetuses from near-term pregnant sheep maintained at sea level (control) or exposed to high altitude hypoxia (HAH). Protein abundances in the left ventricle (LV) tissues were determined by Western blot analyses. The protein levels of phosphor-mTOR in male (A) and female (D) LV tissues. The total protein levels of mTOR in male (B) and female (E) LV tissues. The ratio of LC3B-II to LC3B-I protein levels in male (C) and female (F) LV tissues. Data are means ± SEM of animals from each group and were analyzed by Student t-test. *P < 0.05 vs. control (normoxia). International Journal of Cardiology 2019 274, 7-15DOI: (10.1016/j.ijcard.2018.07.046) Copyright © 2018 Elsevier B.V. Terms and Conditions