Warm-up What is a karyotype? What are chromosomes? Why is a karyotype useful?

Karyotype- an organized profile of all of a person's chromosomes Karyotype- an organized profile of all of a person's chromosomes. In a karyotype, chromosomes are arranged and numbered by size, from largest to smallest. Chromosomes – threadlike structures comprised of DNA and proteins Be creating a genetic profile, it can help identify genetic problems as the cause of a disorder or disease

Karyotypes

Warm-up List three things you learned about DNA What differences between DNA and RNA did you observe?

The Structure of DNA All life on earth uses a chemical called DNA to carry its genetic code or blueprint. In this lesson we be examining the structure of this unique molecule. {Point out the alligator’s eyes in the first picture.} By the way, can you make out what this is? *************************************************************** [The goal of this presentation is to introduce high school biology students to the chemical structure of DNA. It is meant to be presented in the classroom while accompanying the teacher’s lecture, under the control of the teacher.]

DNA Song

We love DNA, made of nucleotides. Sugar, phosphate and a base bonded down one side. Adenine and thymine make a lovely pair, cytosine without guanaine would feel very bare.   de-oxy-ribo-nucleic acid, DNA RNA is ribo-nucleic acid.

History of DNA Early scientists thought protein was the cell’s hereditary material because it was more complex than DNA Proteins were composed of 20 different amino acids in long polypeptide chains

History of DNA Chromosomes are made of both DNA and protein Experiments on bacteriophage viruses by Hershey & Chase proved that DNA was the cell’s genetic material Radioactive 32P was injected into bacteria!

Deoxyribonucleic acid DNA is often called the blueprint of life. In simple terms, DNA contains the instructions for making proteins within the cell. Why is DNA called the blueprint of life?

The Shape of the Molecule DNA is a very long polymer. The basic shape is like a twisted ladder or zipper. This is called a double helix. {Show students a model of the double helix. Explain what a spiral is and a helix is.}

DNA Stands for Deoxyribonucleic acid Made up of subunits called nucleotides Nucleotide made of: 1. Phosphate group 2. 5-carbon sugar 3. Nitrogenous base

Four nitrogenous bases DNA has four different bases: Cytosine C Thymine T Adenine A Guanine G These four bases are abbreviated by using their respective first letters.

Chromosomes are threadlike structures that contain genetic material About 30,000 genes are found on each chromosome Each gene on a chromosome is made up of DNA Each chromosome can have up to 100 million base pairs!!

Discovery of DNA Structure Erwin Chargraff showed the amounts of the four bases on DNA ( A,T,C,G) In a body or somatic cell: A = 30.3% T = 30.3% G = 19.5% C = 19.9%

Chargaff’s Rule Adenine must pair with Thymine Guanine must pair with Cytosine The bases form weak hydrogen bonds T A G C

Chargraff’s Rule: Adenine and Thymine always join together A T Cytosine and Guanine always join together C G

Two Kinds of Bases in DNA Pyrimidines are single ring bases. Purines are double ring bases. N C O C C N C C N

Thymine and Cytosine are pyrimidines Thymine and cytosine each have one ring of carbon and nitrogen atoms. C N O cytosine C N O thymine

Adenine and Guanine are purines Adenine and guanine each have two rings of carbon and nitrogen atoms. C N O Guanine C N Adenine

Question: DNA 5’-CGTATG-3’ What would be the complementary DNA strand for the following DNA sequence? DNA 5’-CGTATG-3’

Answer: DNA 5’-GCGTATG-3’ DNA 3’-CGCATAC-5’

Try it on your own with the PBS DNA Workshop

Pairing Practice AACGTACGATCGATGCACATGCATGGCTACGC

Question: If there is 30% Adenine, how much Cytosine is present?

Answer: There would be 20% Cytosine Adenine (30%) = Thymine (30%) Guanine (20%) = Cytosine (20%) Therefore, 60% A-T and 40% C-G

DNA Double Helix “Rungs of ladder” Nitrogenous Base (A,T,G or C) “Legs of ladder” Phosphate & Sugar Backbone

Two Stranded DNA Remember, DNA has two strands that fit together something like a zipper. The teeth are the nitrogenous bases but why do they stick together? {Point to the 3-D model to show the parts as you discuss them.}

Hydrogen Bonds The bases attract each other because of hydrogen bonds. Hydrogen bonds are weak but there are millions and millions of them in a single molecule of DNA. The bonds between cytosine and guanine are shown here with dotted lines C N O

Hydrogen Bonds, cont. C N O When making hydrogen bonds, cytosine always pairs up with guanine Adenine always pairs up with thymine Adenine is bonded to thymine here

The Double Helix Molecule The DNA double helix has two strands twisted together. We will take apart the DNA molecule to see how it is put together. First, we will look at one strand.

One Strand of DNA The backbone of the molecule is alternating phosphates and deoxyribose sugar The teeth are nitrogenous bases. phosphate deoxyribose {Point to the 3-D mode, if you have one, to show the parts as you discuss them.} bases

Nucleotides O -P O O ATP One deoxyribose together with its phosphate and base make a nucleotide. O -P O O Nitrogenous base C O Phosphate {Ask students where they have seen a similar molecule before in this class. Answer: ATP . Emphasize that nucleotides are the basic building blocks or units of a DNA molecule and that a single molecule has many millions of nucleotides.} C C C Deoxyribose ribose O

One Strand of DNA One strand of DNA is a polymer of nucleotides. One strand of DNA has many millions of nucleotides. {Point to the 3-D mode, if you have one, to show the parts as you discuss them.}

DNA Nucleotide O O=P-O N CH2 O C1 C4 C3 C2 Phosphate Group Nitrogenous base (A, G, C, or T) CH2 O C1 C4 C3 C2 5 Sugar (deoxyribose)

DNA Stands for Deoxyribonucleic acid Made up of subunits called nucleotides Nucleotide made of: 1. Phosphate group 2. 5-carbon sugar 3. Nitrogenous base

Pentose Sugar Sugars are numbered clockwise 1’ to 5’ CH2 O C1 C4 C3 C2 (deoxyribose)

Nitrogenous Bases Double ring PURINES Adenine (A) Guanine (G) Single ring PYRIMIDINES Thymine (T) Cytosine (C) A or G T or C

Base-Pairings Purines only pair with Pyrimidines Three hydrogen bonds required to bond Guanine & Cytosine C G 3 H-bonds

Two hydrogen bonds are required to bond Adenine & Thymine

Review What does DNA stand for? What shape does DNA have? What are the subunits that comprise DNA? What three things make up these sub-units After which part of the subunit is DNA named? Name the 4 bases and pair them according to Chargraff’s rule

Answers Deoxyribonucleic acid Double helix Nucleotides 5-carbon sugar, phosphate, nitrogen base The sugar (deoxyribose) Thymine pairs with Adenine Cytosine pairs with Guanine

DNA and Replication

DNA Stands for Deoxyribonucleic acid Made up of subunits called nucleotides Nucleotide made of: 1. Phosphate group 2. 5-carbon sugar 3. Nitrogenous base

Pentose Sugar Sugars are numbered clockwise 1’ to 5’ CH2 O C1 C4 C3 C2 (deoxyribose)

O O=P-O N CH2 O C1 C4 C3 C2 Phosphate Group Nitrogenous base (A, G, C, or T) CH2 O C1 C4 C3 C2 5 Sugar (deoxyribose)

The Strands are Antiparallel O 1 2 3 4 5 P O 1 2 3 4 5 G C T A

Antiparallel Strands One strand of DNA goes from 5’ to 3’ (sugars) The other strand is opposite in direction going 3’ to 5’ (sugars)

Semiconservative Model of Replication Idea presented by Watson & Crick The two strands of the parental molecule separate, and each acts as a template for a new complementary strand New DNA consists of 1 PARENTAL (original) and 1 NEW strand of DNA DNA Template New DNA Parental DNA

DNA Replication Begins at Origins of Replication Two strands open forming Replication Forks (Y-shaped region) New strands grow at the forks Replication Fork Parental DNA Molecule 3’ 5’

Enzyme Helicase unwinds and separates the 2 DNA strands by breaking the weak hydrogen bonds Single-Strand Binding Proteins attach and keep the 2 DNA strands separated and untwisted

Primase is the enzyme that synthesizes the RNA Primer DNA polymerase can then add the new nucleotides

Direction of Replication DNA Replication DNA polymerase can only add nucleotides to the 3’ end of the DNA This causes the NEW strand to be built in a 5’ to 3’ direction RNA Primer DNA Polymerase Nucleotide 5’ 3’ Direction of Replication

Replication of Strands Replication Fork Point of Origin

Synthesis of the New DNA Strands The Leading Strand is synthesized as a single strand from the point of origin toward the opening replication fork RNA Primer DNA Polymerase Nucleotides 3’ 5’

Synthesis of the New DNA Strands The Lagging Strand is synthesized discontinuously against overall direction of replication This strand is made in MANY short segments It is replicated from the replication fork toward the origin RNA Primer Leading Strand DNA Polymerase 5’ 3’ Lagging Strand 5’ 3’

Lagging Strand Segments Okazaki Fragments - series of short segments on the lagging strand Must be joined together by an enzyme Lagging Strand RNA Primer DNA Polymerase 3’ 5’ Okazaki Fragment

Joining of Okazaki Fragments The enzyme Ligase joins the Okazaki fragments together to make one strand Lagging Strand Okazaki Fragment 2 DNA ligase Okazaki Fragment 1 5’ 3’

Replication of Strands Replication Fork Point of Origin

DNA replication

Overview of Replication

Protein Synthesis

RNA RNA is similar to DNA except for three things: RNA is single stranded RNA has ribose sugar RNA has the nitrogen base uracil (in place of thymine)

Transcription the synthesis of mRNA from a DNA template bases add to make a strand of messenger RNA (mRNA) Occurs in the nucleus

The mRNA now moves away from the DNA and leaves the cell's nucleus. Outside the nucleus, ribosomes attach themselves to the RNA. (remember this is where proteins are made)

Translation The mRNA bases are grouped into sets of three, called codons. Each codon has a complementary set of bases, called an anticodon. Anticodons are a part of transfer RNA (tRNA) molecules.

Attached to each tRNA molecule is an amino acid

Warm-up Please provide the corresponding mRNA, tRNA and amino acids for the following DNA sequence 5' – T A C A G A A C T - 3‘ Is this a leading or lagging strand? Explain. What is a mutation?

DNA T A C A G A A C T mRNA A U G U C U U G A tRNA U A C A G A A C U Amino acids – Methionine -Serine- STOP

According to the table, the codons GGG, GGA, GGC, GGU all code for A According to the table, the codons GGG, GGA, GGC, GGU all code for A. glycine. B. glutamin acid. C. glutamine. D. alanine.

Mutation A change in a DNA sequence Can be caused by: Mistakes in copying Exposure to radiation Exposure to chemicals (mutagens)

Proofreading New DNA DNA polymerase initially makes about 1 in 10,000 base pairing errors Enzymes proofread and correct these mistakes The new error rate for DNA that has been proofread is 1 in 1 billion base pairing errors

DNA Damage & Repair Chemicals & ultraviolet radiation damage the DNA in our body cells Cells must continuously repair DAMAGED DNA Excision repair occurs when any of over 50 repair enzymes remove damaged parts of DNA DNA polymerase and DNA ligase replace and bond the new nucleotides together