Volume 10, Issue 1, Pages 139-149 (July 2004) A single-LTR HIV-1 vector optimized for functional genomics applications  Hong Ma, Tal Kafri  Molecular Therapy  Volume 10, Issue 1, Pages 139-149 (July 2004) DOI: 10.1016/j.ymthe.2004.04.012 Copyright © 2004 The American Society of Gene Therapy Terms and Conditions

Fig. 1 Structure and function of the novel HIV-1 vectors. (A) Graphic maps of the various HIV-1 vectors used in this study. cis-acting elements and gene coding sequences are indicated. These elements include the cytomegalovirus immediate early promoter (CMV), the Rev-response element (RRE), the central polypurine tract (cPPT), the woodchuck hepatitis virus posttranscriptional regulatory element (PRE), the bacterial origin of replication pUC (pUC Ori), the ampicillin-resistance gene (Amp), the green fluorescence protein coding sequence (GFP), and the blastocidin/GFP fusion protein coding region (BSD-GFP). Plasmid-TK113 is a traditional SIN HIV-1 vector. Plasmid TK459 is the parental HIV-1 shuttle vector containing a bacterial origin of replication and antibiotic resistance gene. Plasmid TK469 and pTK479 are a single-LTR and a double-LTR vector, respectively, and were Hirt extracted from vTK459-transduced cells. Plasmid TK485 is a SIN version of pTK469 with sequences in the U3 region including the TATA box and the Sp1 and the NFκB recognition sites deleted. Plasmid TK589 is a single-LTR vector containing a LoxP sequence and an SbfI restriction site that facilitates the rescue of circular vector DNA from the host cell genomes. (B) FACS analysis of GFP expression in 293T cells following transduction with the HIV-1 vectors. (C) Vector titers were determined by scoring GFP expression following serial dilution on 293T cells. Molecular Therapy 2004 10, 139-149DOI: (10.1016/j.ymthe.2004.04.012) Copyright © 2004 The American Society of Gene Therapy Terms and Conditions

Fig. 2 Restriction analysis of single- and double-LTR isolated vector forms. (A) The positions of the NotI and SacII restriction enzyme recognition sites in the single- and double-LTR vectors. (B) Electrophoresis analysis showing the expected DNA fragments of 1.4 and 2.1 kb following NotI/SacII digestion of single- and double-LTR vector DNA, respectively, that was isolated from individual bacterial clones (a–i). The large DNA fragment observed in all of the lanes comprises the vector backbone sequences only, thus the size is not affected by the nature of the LTR. Molecular Therapy 2004 10, 139-149DOI: (10.1016/j.ymthe.2004.04.012) Copyright © 2004 The American Society of Gene Therapy Terms and Conditions

Fig. 3 Transcription of TK469 vector RNAs. (A) Northern analysis of TK469 vector RNA extracted from vector particles transcribed from either transfected single-LTR vector plasmid DNA (lane 1) or integrated DNA containing two LTRs (lane 2). Lane 3, nontransduced 293T cells. (B) Transcription of vector length RNA from circular single-LTR DNA construct is initiated at the R region and traverses the entire vector DNA. In this process the same R region is transcribed twice, and therefore the transcript is longer than the circular DNA template. (C) Transcription from integrated vTK469 vector DNA is initiated at the R region in the 5′ LTR and is terminated at the polyadenylation site after transcribing the R region in the 3′ LTR; thus, the vector transcript is shorter than the integrated DNA template. Molecular Therapy 2004 10, 139-149DOI: (10.1016/j.ymthe.2004.04.012) Copyright © 2004 The American Society of Gene Therapy Terms and Conditions

Fig. 4 Structure and function of the conditional SIN single-LTR vector pTK474. (A) A physical map of pTK474 shows the location of the tetracycline-inducible promoter in the U3 region of the vector's single LTR. (B) FACS analysis of GFP expression in 293T cells transduced with TK474 vector particles generated by transient transfection in the presence (transfection mixture comprising pTK474, ΔNRF, VSV-G, and tTA) or absence (transfection mixture comprising pTK474, ΔNRF, and VSV-G) of tTA. Also indicated are vector titers as determined by scoring GFP expression following serial dilution on 293T cells. Molecular Therapy 2004 10, 139-149DOI: (10.1016/j.ymthe.2004.04.012) Copyright © 2004 The American Society of Gene Therapy Terms and Conditions

Fig. 5 The vTK469 and vTK485 transcription initiation sites. Sequence analysis of TK469 and TK485 5′ RACE clones (nine clones each) was used to identify the transcription initiation sites of vector particle RNAs generated by a transient three-plasmid transfection. (A) The DNA sequence of the transfected pTK469 vector construct and (B) the DNA sequence of the transfected pTK485 vector are shown. (C) Also shown is the expected sequence of a TK469 5′ RACE clone, which was observed in eight of nine RACE clones. This demonstrated that the TK469 vector RNA was initiated at the 5′ end of the R region. (D) Also shown is the sequence of the single TK469 5′ RACE clone exhibiting an aberrant transcription initiation site, as well as (E) the sequences of nine TK485 5′ RACE clones that demonstrate the aberrant transcription initiation site 191 bp upstream of the 5′ end of the single-LTR R region. The U3 region in pTK469 is indicated and its bases are shown in brown letters. The parental nucleotides that were deleted from the U3 region in the SIN vector pTK485 and its RACE clones are shown in red and purple X's. The sequence of the adapter ligated to the 5′ end of the vector RNA in the process of the RACE analysis (GCTGATGGCGATGAACACTGC) is shown in blue letters. Transcription starting at the aberrant initiation site is shown as a purple arrow. The TATA box sequence is shown in red underlined letters. Transcription starting at the traditional initiation sites is shown as a green arrow. The base sequences of the U5 and the primer-binding site (PBS) are shown in blue and red letters, respectively. The nucleotide sequence homologous to the reverse primer used in the 5′ RACE procedure is shown in blue letters. Molecular Therapy 2004 10, 139-149DOI: (10.1016/j.ymthe.2004.04.012) Copyright © 2004 The American Society of Gene Therapy Terms and Conditions

Fig. 6 A single cloning step strategy for generating a bidirectional inducible lentiviral vector. (A) The bidirectional inducible lentiviral vector pTK441 was generated by replacing the polyadenylation signal in the plasmid pBI-GFP with the KM DNA fragment containing all the HIV-1 cis elements required for efficient vector production and transduction. These elements include the woodchuck hepatitis virus posttranscriptional regulatory element (PRE) and the HIV-1 polypurine tract (PPT), LTR, packaging signal, Rev-response element (RRE), and central polypurine tract (cPPT). Cloning the firefly luciferase gene under the control of the bidirectional inducible promoter resulted in the generation of the lentiviral vector pTK450 from which the GFP and the firefly luciferase are expressed under the control of a single inducible promoter. (B) GFP expression in 293T cells in the presence (1–3) and absence (1′–3′) of doxycycline following transduction with the lentiviral vector TK450 at an m.o.i. of 0.1 (1, 1′); after the first round of FACS the (1′) GFP-positive cells were incubated in the presence or absence of DOX (2, 2′), and after the second round of sorting the (2) GFP-negative cells were incubated in the presence or absence of DOX (3, 3′). (C) Luciferase expression (in relative light units per μg protein) in the same cells described above in the presence (1–3) and absence (4–6) of doxycycline following transduction (1, 4), after the first round of FACS for cells that express high level of GFP in the absence of doxycycline (2, 5), and after the second round of FACS for cells that do not express GFP in the presence of doxycycline (3, 6). The level of luciferase induction was calculated as the ratio of luciferase expression in the absence and presence of doxycycline following transduction (7) and after FACS for GFP-expressing cells in the absence of doxycycline (8) and for those cells that do not express GFP in the presence of doxycycline (9). Molecular Therapy 2004 10, 139-149DOI: (10.1016/j.ymthe.2004.04.012) Copyright © 2004 The American Society of Gene Therapy Terms and Conditions