DNA, Mitosis, & Meiosis Review

Slides:



Advertisements
Similar presentations
DNA and Mitosis review/Meiosis
Advertisements

Cell division.
Cell division Review. This spot that holds the 2 chromatid copies together is called a ______________________ centromere.
Cell Reproduction Chapters 9 & 11. Types of Reproduction Mitosis Asexual – only 1 parent needed & the offspring are identical to the parent cell. Meiosis.
Chromosomes and Cell Reproduction
Lesson 9.3: Meiosis: The Life Cycle of Sex Cells Goals: Identify male and female gametes Compare chromosome numbers between somatic cells and gametes.
Meiosis.  Meiosis is a special type of cell division that occurs only in reproductive organs. Meiosis makes reproductive cells called gametes (egg or.
Mitosis & Meiosis. Chromosome Structure  Chromatin – Thin, uncoiled strands of DNA & proteins (histones)  Chromosomes – Rod-shaped structures composed.
Cell Reproduction n Mitosis – asexual reproduction –1 cell produces 2 identical cells n Meiosis – sexual reproduction –1 parent cell produces 4 cells with.
Reduction of Chromosomes. Mitosis Cell duplication (or reproduction) where one cell creates two genetically identical daughter cells Cellular reproduction,
Meiosis Chapter 10.
Meiosis. Now that you know all about DNA…. How is DNA passed from parent to offspring? How is DNA passed from parent to offspring? There are two main.
Cytokinesis (2 nd part of M phase) TWO new nuclei are now in one cytoplasm Cytokinesis: Division of the cytoplasm Animal Cells: The membrane pinches inward.
Section 8-1 Chromosomes Section 8-2 Cell Division Section 8-3 Meiosis
11-4 Meiosis  Describe the process of meiosis.  Compare meiosis and mitosis.
Meiosis November Chromosome Number Diploid- 2 sets of chromosomes –In somatic (body) cells; One comes from mother and one from father –Also referred.
Meiosis.
Mitosis and Meiosis Books
Meiosis Unit 11 continues….
Chapter 8 Cell division Review
MEIOSIS Chapter 11-4 Making reproductive cells …. called the gametes
Cell Cycle.
Cell Division.
Important terms in eukaryotic cell division
Cell Reproduction.
Cell Cycle/Cell Division
Mitosis & Meiosis.
Cell Division—Mitosis Notes
Cell Division—Mitosis Notes
Cell Division
The Cell Cycle & Cell Division
Unit 5.3 Meiosis.
Meiosis Modified by Liz LaRosa 2011.
Cell Growth & Reproduction
Knight Time Find your assigned seat on the chart on station #7.
The Cell Cycle: Creating Somatic Cells
Cell Division—Mitosis Notes
Vocabulary Important Info Headings
The Cell Cycle.
Meiosis Modified by Liz LaRosa 2011.
Copyright Pearson Prentice Hall
Cell Division—Mitosis Notes
Meiosis I results in 2 haploid daughter cells
Unit 4 Jeopardy Cell Division Terms Stages Parts pot luck Q $100
Unit: The Cell Cycle 1.
CHAPTER 8 VOCAB.
CELL CYCLE.
Meiosis.
Cell Growth and Division
Mitosis, Meiosis and Heredity: Meiosis
The Cell Cycle & Cell Division
Cell Division—Mitosis Notes
Meiosis Notes.
The Cell Cycle & Cell Division
Cell Division Review.
Cell Division—Mitosis Notes
Mitosis Review.
Unit 5.3 Meiosis.
Cell Division—Mitosis Notes
Cell Division—Mitosis Notes
Chapter 11 Cell division Review
Cell Division—Mitosis Notes
Cellular Reproduction
Cell Division Mitosis.
Meiosis.
Meiosis SC Standard B4.5- The student will be able to summarize the characteristics of the phases of Meiosis I and II.
Cell Division—Mitosis
Meiosis Division of Sex Cells.
Mitosis: When Cells Divide
Cell Division—Mitosis Notes
Presentation transcript:

DNA, Mitosis, & Meiosis Review

Nucleotide Base – Adenine, Thymine, Guanine, Cytosine, Uracil Sugar – Deoxyribose(DNA) or Ribose (RNA) Phosphate

It’s all about the… BASE PAIR RULE Adenine + Thymine Cytosine + Guanine

DNA STRUCTURE

DNA The order of the nucleotides is the determining factor in the expression of genes in organisms (your traits!) AATGCTTAGGCTGCATTGGAAAACGTAAGTT

DNA Replication DNA replication is the process through which cells copy DNA for transmission to daughter cells during cell division The double helix structure allows DNA to easily unzip down the center between nitrogenous bases Free floating nucleotides attach to each of the separated DNA strands forming 2 new strands of DNA, each an exact copy of the original

mutation A mutation is an unexpected change in a DNA sequence, usually occurring during replication/division

DNA Chromosome: A compact spool of DNA Humans have 46 chromosomes 23 from father 23 from mother

DNA DIPLOID = two sets (full set) of DNA Humans: 46 chromosomes – body cells for growth and repair HAPLOID = one set (half set) of DNA Humans: 23 chromosomes – gametes (sperm & eggs)

Parent Cell 2 Daughter Cells The original cell is called the parent cell; 2 new cells are called daughter cells Before cell division occurs , the cell replicates (copies) all of its DNA, so each daughter cell gets complete set of genetic information from parent cell Each daughter cell is exactly like the parent cell – same kind and number of chromosomes as the original cell 2 Daughter Cells Parent Cell

DNA DNA is located in the nucleus and controls all cell activities including cell division Long and thread-like DNA in a non-dividing cell is called chromatin Doubled, coiled, short DNA in a dividing cell is called chromosome Consists of 2 parts: chromatid and centromere

Coils up into chromosomes Chromatin Coils up into chromosomes Duplicates itself

Mitosis Mitosis – division of the nucleus into 2 nuclei, each with the same number of chromosomes Mitosis occurs in all the somatic (body) cells

Phases Mitosis Meiosis Interphase Interphase I Prophase Prophase I Metaphase Anaphase Telophase Cytokinesis Interphase I Prophase I Metaphase I Anaphase I Telophase I Cytokinesis I -------------------------- Prophase II Metaphase II Anaphase II Telophase II Cytokinesis II

Chromosome Appearance & Location Phase Chromosome Appearance & Location Important Events Interphase Prophase Metaphase Anaphase Telophase Cytokinesis DNA replication, cell grows and replicates organelles DNA copies itself; chromatin Nuclear envelope disappears, spindle fibers form Chromosomes coil up Chromosomes line up in the middle Spindle fibers connect to chromosomes Spindle fibers pull chromosome copies apart to opposite poles Chromosome copies divide and move apart Nuclear envelopes reform, 2 new nuclei are formed, spindle fibers disappear Chromosomes uncoil back into chromatin Division of the rest of the cell: cytoplasm and organelles Chromatin

When chromatin scrunches together it is called a chromosome

This spot that holds the 2 chromatid copies together is called a centromere

Phase of the cell cycle in which the nuclear membrane is present and DNA is spread out into chromatin. interphase

Type of cell division that results in 2 identical daughter cells. mitosis

This network of fibers that attach and pull the chromosomes apart are called______________ Spindle fibers

This cell is in __________________ prophase

This phase of the cell cycle is ______________ anaphase

This phase of the cell cycle is ________________ metaphase

Phase of the cell cycle cell’s spend most of their time in. interphase

Disorder in which body cells lose their ability to control cell division cancer

One of 2 identical arms that make up a chromosome chromatid

Phase of mitosis in which the nuclear membrane and nucleolus disappear and the DNA condenses into chromosomes. prophase

These structures at the poles which attach to the spindle fibers and pull the chromosomes. centrioles

This cell is in ___________ anaphase

This cell is in __________ telophase The cell above is a _________ cell. animal plant Plant You can see the cell plate forming in center instead of a cleavage furrow.

The very first dividing phase is _______________ prophase

Cleavage furrow This is called a This cell is _____________ cell. an animal a plant an animal Plants don’t have cleavage furrows.

Phase of mitosis where the cytoplasm splits into 2 CYTOKINESIS

Meiosis Gametes (sperm/egg), on the other hand, contain only a single set of chromosomes Thus, they have only a single set of genes These cells are called haploid

Meiosis Meiosis is a process of reduction division where the number of chromosomes per cell is cut in half through the separation of chromosomes

Meiosis Each chromosome from mom pairs with it’s corresponding chromosome from dad This structure is called a tetrad. Tetrads contain 4 chromatids.

Meiosis Crossing over – during Meiosis I : Prophase I, when homologous chromosomes are paired together, there are points along the chromosomes that make contact with the other pair. These points of contact can allow the exchange of genetic information between chromosomes.

Meiosis There’s NO chromosome replication before prophase II. no interphase for Meiosis II Cytokinesis I  Prophase II

Gamete Formation In females, normally only 1 of the 4 haploid cells becomes an egg (has most of the cytoplasm). The other 3 cells are called polar bodies and do not take part in reproduction

*In both mitosis and meiosis the cell divides. Mitosis vs. Meiosis 1 round of cell division Results in 2 genetically identical daughter cells Diploid= 2N Somatic (body)Cells 2 rounds of cell division Results in 4 different daughter cells Haploid= N Involved in gamete formation *In both mitosis and meiosis the cell divides.