Quiz#4 LC710 10/04/10 name___________ Q1:Given the following “sense strand” sequence to the Ubx homeodomain: 5’-cgaagacgcggccgacagacatacacccgctaccagacgctcgagctgga gaaggagttccacacgaatcattatctgacccgcagacggagaatcgaga tggcgcacgcgctatgcctgacggagcggcagatcaagatctggttccag aaccggcgaatgaagctgaagaaggagatccag-3’ Design a 5’ and 3’ oligo so that you can amplify this sequence by PCR for future cloning. (1pt) Oligo 1: 5’- 3’ Oligo 2: 5’- 3’ (1pt) _____________________________________________________ Q2: You have identified the 61aa UBX conserved HOMEDOMAIN protein sequence: Nt-RRRGRQTYTRYQTLELEKEFHTNHYLTRRRRIEMAHALCLTERQIKIWFQNRRMKLKKEIQ-Ct Design a 5’ and 3’ oligo from the ends so that you can amplify it by PCR from ANY other organisms. (1pt) Oligo 1: 5’- 3’ Oligo 2: 5’- 3’ (1pt) Genetic Code:

Q3:Given the following protein alignment for part of the UBX protein from 7 species: EcoR1: GAATTC BamHI: GGATCC X=a non consensus amino acid _____________________________________ Make Consensus (1pt) Using consensus amino acid sequence: Design a 5’ and 3’ oligo so that you can amplify some of this homology region from species #1. Add 5’ EcoR1 site Oligo 1: 5’- 3’ Oligo 2: 5’- 3’ _ (1pt) Add 5’ BamHI site (1pt) 1 2 1 2 1 2 1 2 1pt extra credit if you choose your oligos wisely! Genetic Code: