PTB1 nPTB Ai Aii GM03201 P1+N1 GM2132 P1+N1 GM2132 C1 GM2132 P1

Slides:



Advertisements
Similar presentations
A b Supp. Figure 1: Anoikis-resistance of MDA-MB-231 is dependent on PI3Kγ (a) Cells were prevented from attaching for 48 hours in the presence of DMSO,
Advertisements

Supplementary Figure 1. Caspase 8 expression and activation and Fas expression in NSCLC and normal lung cell lines. A Western blot analysis of DR4 and.
Control siRNA BRG1 siRNA PTEN – Akt – p-Akt – p-GSK-3  – Cyclin D1 – BRG1 –  -actin – SW480 Supplemental data S1 Supplemental data S1. Effects of transduction.
ß-gal NME2 NME1 Actin NME1 NME2 Scrambled RISC Free Supplementary data Figure 1B. Antibody L-15 is specific for NME2 and sc-465 is specific for NME1. Western.
(+++) Normal breast ATM (++) IDC ATM Lymph node metastasis negative positive P-value A B X200 C Vector ATM - WT.
Are over ‑ expressed alternative survivin transcripts in human bladder cancer suitable targets therapeutic targets? Daniela Wuttig *, Doreen Kunze, Susanne.
Supplementary Figure 1. mRNA induction/repression kinetics of HXK1, GAL1::FMP27 and INO1 (A) RT-qPCR analysis of HXK1 kinetic response to Galactose induction.
SiRNA-mediated inhibition of antiapoptotic genes in human bladder cancer cells siRNA-mediated inhibition of antiapoptotic genes in human bladder cancer.
Supplemental Figure 1 Human serum Mouse serum Incubation time (hr) RNA remaining, AU Supplemental Figure 1 – EpCAM-AsiCs are stable in human and mouse.
C H-NS (nM) 14 nM FIS28 nM FIS56 nM FISno FIS Figure S1. FIS and H-NS can simultaneously interact with cspA promoter.
From: Regulation of Cdc42 Expression and Signaling Is Critical for Promoting Corneal Epithelial Wound Healing Invest. Ophthalmol. Vis. Sci ;54(8):
Fig. 5. Effect of JGH43IA on the expression of neuronal survival and death related proteins. Western blot analysis of neuronal cell survival and death.
miRNA transfection using oligofectamine
A B C Supplementary Figure S1. Trabectedin decreases viability of primary MPM cell cultures. A and B, dose-dependent impact of trabectedin on epithelioid.
Retinoic acid–induced cell cycle arrest of human myeloid cell lines is associated with sequential down-regulation of c-Myc and cyclin E and posttranscriptional.
Supplementary information
A. D. B. C. - ΔNP63α - β-Actin IMEC - SUM MDA-MB IMEC
Suppl.Figure 1 Transfected HEK293 cells -130kDa -100KDa Blot: -V5
Volume 132, Issue 5, Pages (May 2007)
Expression and Function of RIG-I in Oral Keratinocytes and Fibroblasts
Proline supplementation during P5CS protein knockdown suppressed GCN2 activation. Proline supplementation during P5CS protein knockdown suppressed GCN2.
(A-B) Expression of dominant negative p73. (C) Knockdown of p73
Pioglitazone inhibits aromatase expression in human preadipocytes.
Supplementary Figure 2. AKT1 AKT1 AKT2 pAKT ERK pERK A1847 A2780 CaOV3
Supplementary 3 PTB PTB Actin Actin GM1953 control 0.03
Supplementary Information 1
Fig. 2. STUB1 destabilizes and ubiquitinates TF and mediates TF regulation by AHR. STUB1 destabilizes and ubiquitinates TF and mediates TF regulation by.
Yang Shen, Monica Naujokas, Morag Park, Keith Ireton  Cell 
Active Caspase-1 Is a Regulator of Unconventional Protein Secretion
Interfering with HMGA2 expression blocks transformation in metastatic lung cancer cells. Interfering with HMGA2 expression blocks transformation in metastatic.
p53 stabilization is decreased upon NFκB activation
Volume 3, Issue 2, Pages (February 2006)
Leto et al., Supplementary Figure S3
Effect of expression of constitutively active CAMKK2 on AMPK activation and the cell cycle in G361 cells. Effect of expression of constitutively active.
Involucrin Expression Is Decreased in Hailey–Hailey Keratinocytes Owing to Increased Involucrin mRNA Degradation  Karin M. Aberg, Emoke Racz, Martin J.
Figure S3. Zhang et al. A B Myc-SIRT1 - + sir2a+/+ sir2a-/-
Changes in mutation rate or protein abundance are not observed in HATs when comparing rho+ to rho0 cells. Changes in mutation rate or protein abundance.
Titration of antisera against the amount of extract loaded on Western blots. Titration of antisera against the amount of extract loaded on Western blots.
The effects of laminarin, PMA and zymosan on PKC phosphorylation.
Fig. 6. Effect of SAHA and ML on histone acetylation, BAX, and p21CDKN1A expression.PANC-1 and BxPC-3 cells were incubated for 48 hours with 5 µM.
Figure 4 DNM1 mutations affect protein levels and self-dimerization (A) HeLa cells were transfected with green fluorescent protein (GFP)-tagged mutant.
PTK6 downregulation suppresses SNAIL and increases E-cadherin expression. PTK6 downregulation suppresses SNAIL and increases E-cadherin expression. A,
JAK3A572V mutation causes constitutive JAK3 activity and IL-2–independent proliferation of NKTCL cells. JAK3A572V mutation causes constitutive JAK3 activity.
(fold of TGF-β1 response)
Stability of SsbA (A) and GFP (B) proteins in UA159 and ΔclpX strains.
Effect of the siRNA-mediated knockdown of endogenous MARCH8 on the expression levels of MARCH8 substrates, TfR and CD98, in HepG2 cells. Effect of the.
miR-145 regulates IGF1R expression.
Correlation of MAGE-A1 expression with PFS in patients treated with FRD and knockdown of MAGE-A in HMCLs. MAGE-A1 expression is correlated with resistance.
Downregulation of caveolin-1 by si-RNA in NIH3T3 cells increased survivin expression. Downregulation of caveolin-1 by si-RNA in NIH3T3 cells increased.
Fig. 6. RhoB is required for Rnd3-induced stress fibre formation
Reduced albumin uptake in myotubes expressing the TFT mutant caveolin-3. Reduced albumin uptake in myotubes expressing the TFT mutant caveolin-3. (A) Control.
BCL-3 regulates expression of stemness-associated Wnt targets.
Lats2 functions at the G1–S checkpoint in U2OS cells.
co-IP of LEDGF/p75 and MeCP2.
Quantification of NMT knockdown.
Targeting eIF4E increases ZEB1 protein and mRNA levels and decreases ZEB1-targeting miR-200c and miR-141 microRNAs. Targeting eIF4E increases ZEB1 protein.
Runa Sur, Peter A. Lyte, Michael D. Southall 
Representative Western blot analyses of S-phase and other proteins from PC3 cell lysates obtained 3 days after oligomer (400 nm)/Lipofectin (15 μg/ml)
FOXO3a phosphorylation and expression.
Imatinib mesylate inhibits PDGF-mediated ERK and Akt activation.
ALDH1A3 is mainly responsible for the ALDH activity in two human cholangiocarcinoma lines. ALDH1A3 is mainly responsible for the ALDH activity in two human.
CXCR4 expression levels of MDA-MB-231 cells at 48 hours posttransfection of CXCR4 siRNAs. CXCR4 expression levels of MDA-MB-231 cells at 48 hours posttransfection.
Pirh2 represses p73-dependent transactivation.
Fig. 3. KMS99220 inhibits activation of NFκB signaling via HO-1 induction. (A) BV2 cells were treated with 10 µM KMS99220 for 1 h, and then treated with.
WP1066 induces caspase-dependent apoptosis.
Effect of bevacizumab on the proliferation of A2780 cells.
Induction of PARP cleavage (A) and activation of caspases (B) after treatment with a combination of TRAIL and cisplatin. Induction of PARP cleavage (A)
Expression and induction of HER2 and HPSE in 231BMBC cells.
Knockdown of NR4A1 induces endoplasmic reticulum stress–mediated apoptosis by increasing ROS production in pancreatic cancer cells. Knockdown of NR4A1.
Time course of NMT knockdown.
Presentation transcript:

PTB1 nPTB Ai Aii GM03201 P1+N1 GM2132 P1+N1 GM2132 C1 GM2132 P1 GM03201 siP2 GM2132 C2 GM2132 siP2 GM03201 C2 PTB1 PTB nPTB c-Myc Actin Actin Supplementary 2: Reducing PTB-1 and nPTB expression combined decreases the expression levels of c-Myc in control and MM derived cell lines to the same extent as PTB-1 knockdown alone. To reduce PTB/nPTB expression approximately 2 x 106 cells were mixed with 100µl of solution L (Amaxa/Lonza) and 10nM of appropriate siRNA PTB to P1 (AAC UUC CAU CAU UCC AGA GAA) nPTB or control C1 (AAG GUC CGG CUC CCC CAA AUG) and grown overnight in DMEM 10% FCS. Cells were subjected to Amaxa programme X-001 and then incubated in 10ml RPMI at 37ºC. Cells were harvested after 48 hours and lysates used for western blot analysis. These were then probed with anti-bodies raised against PTB or nPTB. Actin was used as a loading control. As has been shown previously (Boutz et al 2007) reducing PTB1 expression increases the level of nPTB. The blots were probed with anti-bodies directed against c-Myc, PTB and nPTB as shown. Actin was used as a loading control. Aii) To confirm that the data obtained by PTB specific the experiment was repeated using an alternative siRNA (P2 AAGUUCGGCACAGUGUUGAAGUU ). As before a reduction in PTB1 correlates with a decrease in c-Myc expression. The data show that the decrease in c-Myc expression observed with PTB1 knockdown (Figure 4) was not due to an upregulation of nPTB.