A atgaagacagtgactggacctttgttcctgtgcttctggctgcagctgaactgtgtgagcagaggcgagcaggtggagcagcgccctcctcacctgagtgtccgggagggagacagtgccgttatcatctgcacctacacagaccctaacagttattacttcttctggtacaagcaagagccgggggcaggtcttcagttgcttatgaaggttttctcaagtacggaaataaacgaaggacaaggattcactg

Slides:

Advertisements

Similar presentations

The Build-up of the Red Sequence at z

Advertisements

Ig Polypeptides Are Encoded by Multiple Gene Segments LIGHT CHAIN

Volume 19, Issue 2, Pages (February 2011)

Volume 15, Issue 6, Pages (June 2007)

Volume 16, Issue 3, Pages (March 2008)

Volume 24, Issue 7, Pages (July 2016)

Making Proteins in the Powerhouse

Schematic diagram of the three circuits analysed in this work.

A B C Gentile et al., Figure 1A Gentile et al., Supplementary Figure 1

Dominant Effects of Δ40p53 on p53 Function and Melanoma Cell Fate

Ribosome Biogenesis: Ribosomal RNA Synthesis as a Package Deal

Volume 24, Issue 7, Pages (July 2016)

Volume 19, Issue 3, Pages (April 2017)

Tiago R. Matos, Menno A. de Rie, Marcel B.M. Teunissen

Volume 25, Issue 3, Pages (March 2017)

(A) Block diagram of the precursor proteins predicted from the Oak1, 2, 3, and 4 clones showing the signal peptide (light shading), the regions corresponding.

Therapeutic levels of fetal hemoglobin in erythroid progeny of β-thalassemic CD34+ cells after lentiviral vector-mediated gene transfer by Andrew Wilber,

Volume 12, Issue 4, Pages (October 2005)

Volume 11, Issue 6, Pages (May 2015)

Volume 14, Issue 4, Pages (October 2006)

Volume 11, Issue 6, Pages (June 2005)

Transcription: Identification of a prime suspect

Neeltje A Kootstra, Ryusuke Matsumura, Inder M Verma Molecular Therapy

Immunodominant-Peptide Recognition: Beta Testing TCRαβ

Volume 10, Issue 1, Pages (July 2004)

Enhanced sensitivity to inhibition of SHP2, STAT5, and Gab2 expression in chronic myeloid leukemia (CML)‏ by Michaela Scherr, Anuhar Chaturvedi, Karin.

Rewriting the Epigenome

Expression of the MOZ-TIF2 oncoprotein in mice represses senescence

Identification of essential genome features.

Volume 19, Issue 7, Pages (July 2011)

Volume 25, Issue 8, Pages (August 2017)

Volume 23, Issue 6, Pages (December 2005)

Volume 16, Issue 12, Pages (December 2008)

Volume 31, Issue 1, Pages (July 2009)

Synaptic Ménage à Trois

Thijn R Brummelkamp, René Bernards, Reuven Agami Cancer Cell

Volume 15, Issue 5, Pages (May 2007)

Nat. Rev. Cardiol. doi: /nrcardio

Volume 19, Issue 2, Pages (February 2011)

A Movie of RNA Polymerase II Transcription

RND efflux operons in P. aeruginosa.

The Shaping of the T Cell Repertoire

Volume 21, Issue 4, Pages (April 2013)

Volume 12, Issue 10, Pages (September 2015)

Volume 133, Issue 4, Pages (May 2008)

Volume 12, Issue 3, Pages (March 2000)

Volume 16, Issue 4, Pages (April 2008)

Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing Pavel I. Ortinski, Bernadette.

Volume 89, Issue 2, Pages (April 1997)

Regulatory Nascent Peptides in the Ribosomal Tunnel

Fig. 5. Mapping of HBV S transcripts from HBeAg-positive and HBeAg-negative chimpanzees. Mapping of HBV S transcripts from HBeAg-positive and HBeAg-negative.

Volume 15, Issue 11, Pages (November 2007)

Volume 15, Issue 4, Pages (April 2007)

Generation and molecular characterization of LV producer cell lines

Production of lentiviral vectors

Fig. 2. Increased CD19 CAR-T cell expansion and persistence after Cy/Flu lymphodepletion. Increased CD19 CAR-T cell expansion and persistence after Cy/Flu.

Volume 17, Issue 6, Pages (June 2009)

A Correlation between TCR Vα Docking on MHC and CD8 Dependence

Molecular Therapy - Methods & Clinical Development

A New Angle on TCR Activation

Volume 15, Issue 9, Pages (September 2007)

Figure 4 Vα7.2 TCR chain repertoire Analysis of the T-cell receptor (TCR) Vα7.2 repertoire of patient A by pyrosequencing shows oligoclonal T-cell expansions.

Andrew Peters, Ursula Storb Immunity

Molecular Therapy - Nucleic Acids

Construction of the Tet-CD19CAR vector and surface CAR expression of Tet-CD19CAR–transduced SUP-T1 cells. Construction of the Tet-CD19CAR vector and surface.

Volume 8, Issue 1, Pages (July 2003)

CD4-CTL effectors share TCR clonotypes with CD4-CTL precursors.

Volume 21, Issue 5, Pages (May 2013)

A, Schematic diagram of identified splice variants of PD-L1.

A Double-Switch Vector System Positively Regulates Transgene Expression by Endogenous microRNA Expression (miR-ON Vector) Mario Amendola, Alice Giustacchini,

Presentation transcript:

A atgaagacagtgactggacctttgttcctgtgcttctggctgcagctgaactgtgtgagcagaggcgagcaggtggagcagcgccctcctcacctgagtgtccgggagggagacagtgccgttatcatctgcacctacacagaccctaacagttattacttcttctggtacaagcaagagccgggggcaggtcttcagttgcttatgaaggttttctcaagtacggaaataaacgaaggacaaggattcactgtcctactgaacaagaaagacaaacaactctctctgaacctcacagctgcccatcctggggactcagccgtgtacttctgcgcagtctccgggactggaggctataaagtggtctttggaagtgggactcgattgctggtaagccctgacatccagaacccagaacctgctgtgtaccagttaaaagatcctcggtctcaggacagcaccctctgcctgttcaccgactttgactcccaaatcaatgtgccgaaaaccatggaatctggaacgttcatcactgacaaaactgtgctggacatgaaagctatggattccaagagcaatggggccattgcctggagcaaccagacaagcttcacctgccaagatatcttcaaagagaccaacgccacctaccccagttcagacgttccctgtgatgccacgttgactgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagccggatttaacctgctcatgacgctgaggctgtggtccagtagagtgaagagaggcagcggcgccaccaacttctccctgctgaagcaggccggcgacgtggaagaaaaccctggccccatggctacaaggctcctctgttacacagtactttgtctcctgggtgcaagaattttgaattcaaaagtcattcagactccaagatatctggtgaaagggcaaggacaaaaagcaaagatgaggtgtatccctgaaaagggacatccagttgtattctggtatcaacaaaataagaacaatgagtttaaatttttgattaactttcagaatcaagaagttcttcagcaaatagacatgactgaaaaacgattctctgctgagtgtccttcaaactcaccttgcagcctagaaattcagtcctctgaggcaggagactcagcactgtacctctgtgccagcaaccaactggggtcctcctatgaacagtacttcggtcccggcaccaggctcacggttttagaggatctgagaaatgtgactccacccaaggtctccttgtttgagccatcaaaagcagagattgcaaacaaacaaaaggctaccctcgtgtgcttggccaggggcttcttccctgaccacgtggagctgagctggtgggtgaatggcaaggaggtccacagtggggtcagcacggaccctcaggcctacaaggagagcaattatagctactgcctgagcagccgcctgagggtctctgctaccttctggcacaatcctcgaaaccacttccgctgccaagtgcagttccatgggctttcagaggaggacaagtggccagagggctcacccaaacctgtcacacagaacatcagtgcagaggcctggggccgagcagactgtggaatcacttcagcatcctatcatcagggggttctgtctgcaaccatcctctatgagatcctactggggaaggccaccctatatgctgtgctggtcagtggcctggtgctgatggccatggtcaagaaaaaaaattcctgataa Dark Green: S4-12 TCR alpha Red: P2A Sequence Light Green: S4-12 TCR beta B (Cho et al. BJC TH-2017-4419R)

Supplementary Figure S1 Supplementary Figure S1. Schematic diagram of the constructs with murine TCR S4-12 specific to LMP1166/HLA-A2 complexes. A. The cDNA sequence of the cloned TCR (Dark Green) and TCR (Light Green) of TCR S4-12 , which are linked with furin-sensitive spacer-P2A ribosomal skip peptide sequence (Red). B. Complementarity Determining Regions (CDRs) of cloned murine TCR S4-12. The CDR sequences of the TCRα and TCRβ chains are shown. C. The cDNA encoding murine TCR and TCR, which are linked with furin-sensitive spacer RVKRGSG-P2A ribosomal skip peptide sequence ATNFSLLKQAGDVEENPGP, was inserted into the pCDH-EF1 lentiviral vector that has a constitutive elongation factor 1α (EF1) promoter for transcription of cloned cDNA insert. RRE, Rev response element; WPRE, Woodchuck hepatitis virus posttranscriptional regulatory element. (Cho et al. BJC TH-2017-4419R)