Objectives: Compare and contrast the structures of DNA and RNA Compare and contrast the structures of DNA and RNA Describe how DNA replicates Explain how a protein is produced Distinguish between the functions of mRNA, tRNA, and rRNA in translation Determine DNA, RNA, and protein sequences when given any complementary sequence Copyright © 2009 Pearson Education, Inc.

Distinguish between exons and introns and describe the steps in RNA processing that lead to a mature mRNA Explain the relationship between DNA genotype and the action of proteins in influencing phenotype Distinguish between the effects of base substitution and insertion or deletion mutations Copyright © 2009 Pearson Education, Inc.

The Connection Between Genes and Proteins FROM GENE TO PROTEIN The Connection Between Genes and Proteins

transcription and translation The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation replication

Transcription and Translation (linking gene to protein: an overview) Genes provide the instructions for making specific proteins. The bridge between DNA and protein synthesis is RNA.

DNA Transcription RNA Nucleus Cytoplasm Translation Protein DNA Transcription RNA Nucleus Cytoplasm Figure 10.6A Flow of genetic information in a eukaryotic cell. Transcription is the production of RNA using DNA as a template. In eukaryotic cells, transcription occurs in the nucleus, and the resulting RNA (mRNA) enters the cytoplasm. Translation is the production of protein, using the sequence of nucleotides in RNA. Translation occurs in the cytoplasm for both prokaryotic and eukaryotic cells. Translation Protein

Ribosome – organelle that serves as the site of protein synthesis Transcription – process by which a portion of one DNA strand, the template strand, provides a template for synthesis of a complementary RNA strand (mRNA). Translation – process in which the 3 types of RNA work together to create a sequence of amino acids (a protein) Ribosome – organelle that serves as the site of protein synthesis Fig. 17.3

RNA differs from DNA… Sugar RNA has ribose sugar DNA has deoxyribose sugar Nitrogen bases RNA has uracil in place of thymine Structure RNA is usually single-stranded

Three types of RNA 1) mRNA (messenger) – carries DNA message from the nucleus into the cytoplasm 2) tRNA (transfer) – carries amino acids to the ribosomes to be added to the growing chain of amino acids (protein) 3) rRNA (ribosomal) – makes up part of the ribosome

Bases in RNA Adenine (A) pairing: Uracil (U) DNA RNA Guanine (G) A - U Cytosine (C) G – C C – G T - A

The Synthesis and Processing of RNA

Step 1: Transcription produces genetic messages in the form of RNA Overview of transcription The two DNA strands separate temporarily A portion of one strand is used as a pattern (template) to produce an RNA chain, using specific base pairing For A in DNA, U is placed in RNA RNA polymerase catalyzes the reaction separates the DNA strands at the appropriate point and bonds the RNA nucleotides as they base-pair along the DNA template. can only add nucleotides to the 3’ end of the growing chain. The location of the promoter determines which strand will be used as a template. Once RNA polymerase binds to the promoter, the strand oriented 3′  5′ is used as a template, since transcription occurs in a 5′  3′ direction. It is important to emphasize that the start and stop transcription signals differ from the start and stop codons of translation. The start and stop codons are located at the ends of the protein-coding sequence. Messenger RNAs contain additional sequences both before and after the protein-coding region because transcription begins in the upstream promoter and ends at the downstream terminator. For operons in prokaryotic cells (see Module 11.1), transcription of multiple genes will be controlled by one promoter and one terminator, but each gene will have a start and stop codon for translation of its corresponding protein. Student Misconceptions and Concerns 1. Beginning college students are often intensely focused on writing detailed notes. The risk is that they will miss the overall patterns and the broader significance of the topics discussed. Consider a gradual approach to the subjects of transcription and translation, beginning quite generally and testing comprehension, before venturing into the finer mechanics of each process. 2. As students learn about transcription, they might wonder which of the two strands of DNA is read. This uncertainty may add to the confusion about the details of the process, and students might not even think to ask. As noted in Module 10.9, the location of the promoter, a specific binding site for RNA polymerase, determines which strand is read. Teaching Tips 1. Another advantage to the use of RNA to direct protein synthesis is that the original code (DNA) remains safely within the nucleus, away from the many potentially damaging chemicals in the cytoplasm. This is like making photocopies of important documents for study, keeping the originals safely stored away. Copyright © 2009 Pearson Education, Inc.

Transcription (DNA  RNA) Making mRNA synthesis of complementary RNA strand transcription bubble enzyme _RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A G T C T T C T C A T A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5

Transcription RNA polymerase attaches to the promoter region of gene to start Transcription nucleotides are added to the 3’ end of the growing strand Continues until it reached the terminator sequence in the DNA

Behind the point of RNA synthesis, the double helix re-forms and the RNA molecule peels away. Fig. 17.6b Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings

Example: DNA Strand TA CGCAC ATTT ACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC

Step 2: Modification of RNA after transcription (Eukaryotes) = Post-transcriptional processing Enzymes in the nucleus modify the pre-mRNA before it leaves the nucleus and exits into the cytoplasm. a 5’ cap is added at one end At the 3’ end, an enzyme adds 50 to 250 adenine nucleotides, the poly(A) tail.

Introns: noncoding segments that are cut out from the molecule RNA Splicing: The removal of a large portion of the RNA molecule. Introns: noncoding segments that are cut out from the molecule Exons: coding regions that will be translated into amino acid sequences are spliced together 3' poly-A tail 3' A A A A A 5' cap mRNA 50-250 A’s P P 5' G P intron = noncoding (inbetween) sequence eukaryotic RNA is about 10% of eukaryotic gene. ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

Addition of cap and tail Cap Exon Intron Exon Intron Exon DNA Transcription Addition of cap and tail Cap RNA transcript with cap and tail Introns removed Tail Exons spliced together mRNA Coding sequence Nucleus Figure 10.10 The production of eukaryotic mRNA. Cytoplasm

Translation from nucleic acid language to amino acid language Using the mRNA code to make protein

So transcription created mRNA, then it was processed, left the nucleus…..now what? Where’s the protein? Translation is next! Protein?

DNA strand Transcription RNA Codon Translation Polypeptide Amino acid DNA strand Transcription RNA Codon Translation Figure 10.7 Transcription and translation of codons. Polypeptide Amino acid

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

The universal code Code for ALL life! strongest support for a common origin for all life Start codon AUG methionine Stop codons UGA UAA UAG Strong evidence for a single origin in evolutionary theory. Several different codons often specify the same amino acid

Strand to be transcribed DNA Transcription RNA Figure 10.8B Deciphering the genetic information in DNA. Start codon Stop codon Translation Polypeptide Met Lys Phe

Step 3: Translation RNA-directed synthesis of a polypeptide a cell interprets a series of codons along a mRNAmolecule. Transfer RNA (tRNA) transfers amino acids to a ribosome. The ribosome adds each amino acid carried by tRNA to the growing end of the polypeptide chain. Fig. 17.12

Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

Anticodon – sequence at tip of tRNA that is complementary to the codons of mRNA (determines which amino acid will attach to the growing amino acid chain)

Initiation – ribosome, mRNA and first tRNA come together Elongation - the addition of amino acids to the polypeptide chain; continues until the ribosome reaches a stop codon Fig. 17.17 Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings

What is a mutation????? A sudden, rare change in the DNA of a gene Are they always bad? A sudden, rare change in the DNA of a gene NO  could be helpful or harmful, but most have no effect

Point mutations can affect protein structure and function A chemical change in just one nucleotide of a gene causes a point mutation. Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings

Types of Point Mutations Three Types 1. Substitution: one nucleotide is substituted for another. (usually only changes one amino acid) 2. Insertion: a nucleotide is added . 3. Deletion: a nucleotide is removed. Insertion & deletion point mutations lead to: Frameshift Mutations: the “reading frame” of the genetic message is shifted.

Mutations can change the meaning of genes Mutations can be Spontaneous: due to errors in DNA replication or recombination Induced by mutagens High-energy radiation Chemicals Student Misconceptions and Concerns 1. Beginning college students are often intensely focused on writing detailed notes. The risk is that they will miss the overall patterns and the broader significance of the topics discussed. Consider a gradual approach to the subjects of transcription and translation, beginning quite generally and testing comprehension, before venturing into the finer mechanics of each process. 2. Mutations are often discussed as part of evolution mechanisms. In this sense, mutations may be considered a part of a positive creative process. The dual nature of mutations, potentially deadly yet potentially innovative, should be clarified. Teaching Tips 1. A simple way to demonstrate the effect of a reading frame shift is to have students compare the following three sentences. The first is a simple sentence. However, look what happens when a letter is added (2) or deleted (3). The reading frame, or words, are re-formed into nonsense. (1) The big red pig ate the red rag. (2) The big res dpi gat eth ere dra g. (3) The big rep iga tet her edr ag. 2. The authors have noted elsewhere that “A random mutation is like a shot in the dark. It is not likely to improve a genome any more than shooting a bullet through the hood of a car is likely to improve engine performance!” Copyright © 2009 Pearson Education, Inc.