‘A stimuli responsive DNA walking device’ COMMUNICATION www.rsc.org/chemcomm | ChemComm ‘A stimuli responsive DNA walking device’ Chunyan Wang, Jingsong Ren* and Xiaogang Qu Laboratory of Chemical Biology and State Key laboratory of Rare Earth Resources Utilization, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun, 130022, China Received 5th October 2010, Accepted 3rd November 2010 DOI: 10.1039/c0cc04234j

Previous reports: Recently, significant efforts have been expended to the fabrication of DNA walking nanomotors with foot-like components that each can bind or detach from an array of anchorage groups on the track, and transport an object from one location to another on a nanometre scale. F. C. Simmel, Chemphyschem., 2009, 10, 2593.

There are two kinds of transportation reported: (1)Strand displacement assay in which the walking system can be fueled through adding a more energy favorable strand. For example, a DNA biped system in which the walker moved with precise bidirectional control via strand displacement. (2)Another is an enzyme powered approach. Restriction endonuclease, DNAzyme and Polymerase had been reported individually to drive the unidirectional DNA walker. J. AM. CHEM. SOC. 2004, 126, 10834-10835

Present study : The first report of a pH responsive walking system in which a walker strand could move along a track and accomplish transportation of cargo under environmental stimuli. Scheme 1 Schematic illustration of the walker locomotion. Green sphere represents fluorescent dye (ROX) and brown sphere represents quencher (BHQ-2). The diagrams depict (a) unbound walker; (b) walker anchors to site A; (c) walker anchors to site B.

Materials : T1: 5’-ACTCTTGACGCACTAGTACGGGATCGTATTCATTGAGTTACA-3’ S1: 5’-CCGTACTAGTGCGTCAAGAGTTTAGTAGCCTACCACACCAACCATCGTC -3’ 5’-CCGTACTAGTGCGTCAAGAGTTTAGTAGCCAACCACACCAACCATCG TC-3’-BHQ-2 S2: 5’-TGTAACTCAATGAATACGATCTTTATAGCGAGATTGACAGCCTA-3’ W1: 5’-GACGATGGTTGGTGTGGTTGGTAGGCTACTGTCAATCTCGCTAAT-3’ ROX-5’-GACGATGGTTGGTGTGGTTGGTAGGCTACTGTCAATCTCGCTAAT- 3’

Methods for analysis : (1) Electrophoresis. (2) Fluorescence spectra. Native polyacrylamide gel electrophoresis technique was used to confirm the proper associations between the walker and track. (2) Fluorescence spectra. Fluorescent measurements was used to monitor the real time motion of the walker. (3) Fluorescence time course measurements. The walker locomotion was further confirmed by fluorescence time course measurements. The walker strand can continuously switch between site A and B when the solution pH oscillates between 5.5 and 8.0.

Fig. 1 Electrophoretic analysis of the device at two solution conditions: pH8.0 and pH5.5. Lane1:strand(T+S1+S2); lane2: strand (T + S1 + S2) +W; lane 3: strand (T + S1 + S2) + W + thrombin.

Fig. 2 Fluorescence spectra change of ROX while attached to the track under different pH. (A) Spectra of walker before (black line) and after attached to the track (red line) under pH 8.0, spectra of the walker at pH 5.5 (blue line). The spectra was recorded from 590 nm to 650 nm at an excitation wavelength length of 580 nm, both slits were set to 5 nm. (B) Cycling the DNA walker in the absence of thrombin. The intensity change at 603 nm was recorded.

Conclusion : (1) In conclusion, we have shown a novel strategy to construct a stimuli responsive DNA walker system powered by protons. (2) This kind of DNA walker is robust and reversible without the need of injecting external energy. (3) Many other sequences that widely exist in living systems and play key roles in many biological processes could be introduced into the system through rational design and DNA devices with more intricate functions could be constructed.

THANK YOU