December 19, 2017 Journal: What is the difference between how nucleotides are added to the leading and lagging strands in DNA replication?

Slides:

Advertisements

Similar presentations

Defined: a change in an organism’s DNA Where: DNA or Chromosomes When: During replication, Synapses, or Crossing-Over Mutations can affect a single.

Advertisements

RNA and Protein Synthesis

MUTATIONS SC STANDARD B-4.9: The student will exemplify ways in which new characteristics are introduced into an organism or a population.

Mutations Chapter 12.4.

Gene Regulations and Mutations

12-4 Mutations Objective: Contrast gene mutations & chromosomal mutations Are all mutations bad?

Mutations Genetic Changes.

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

What ’ s the Purpose of All This DNA Stuff? *Sequence of nitrogen bases along the DNA strand (genes) code for an amino acid sequence (which make up proteins)

Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,

Slide 1 of 24 Copyright Pearson Prentice Hall 12-4 Mutations 12–4 Mutations.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

Slide 1 of 24 VIII MUTATIONS Mutations Types of Mutations:

Genetic Mutations Biology Chapter 12.4 Wilson.  Describe the different types of genetic mutations.  Describe the different types of chromosomal mutations.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

Protein synthesis continued.  Transcription is step 1  DNA  mRNA  Nucleus  RNA polymerase.

Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

Biology Review Benchmark Test #3

Mutations: Definition: Changes in DNA in an organism. These changes can be problematic, can be helpful, or can have no effect. Mutations are what DRIVES.

Mutation Notes: Chapter 11.

Mutations and Nature vs. Nurture.

Gene Mutations.

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,

Types of Mutations.

Gene Mutations.

Mutations TSW identify and describe the various types of mutations and their effects.

Chromosomes and Cell Cycle

Types of point mutations

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

Kinds of Mutations Point Mutation Occur at a single point in the DNA

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.

A mutation is a change in an organism’s DNA.

Topic #3: Types of Mutations

12.4 Mutations Kinds of Mutations Significance of Mutations.

Gene and Chromosomal Mutations

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

DNA: The Blueprints For Life

Mutation: Some Definitions

Read the lab handout COMPLETELY

Mutation, Natural Selection, and Artificial Selection

Mutation Notes.

Copyright Pearson Prentice Hall

Section 20.4 Mutations and Genetic Variation

DNA Mutations Types & their effects.

Copyright Pearson Prentice Hall

Gene Mutations.

Presentation transcript:

December 19, 2017 Journal: What is the difference between how nucleotides are added to the leading and lagging strands in DNA replication?

Mutations, Chromosomes, and Karyotypes

Eukaryotic Chromosomes Made of DNA and protein Function is to pass on traits

When a cell is not dividing, chromosomes are long, thin strands Before division, they get short & thick and form chromosomes

Each organism has a characteristic # of chromosomes Ex. Humans have 46 chromosomes Sexually reproducing organisms have 2 sets with same type of genetic info

Arranged in a karyotype that shows all our 46 chromosomes as 23 pairs

Genes: Sections of chromosomes Vocabulary Genes: Sections of chromosomes Chromatin: DNA + Proteins that make up chromosomes Centromere: The middle of the chromosome that holds the two sister chromatids together

Genes are Sections of Chromosomes

Mutations involve Changes in DNA May be caused by environmental factors called mutagens

Chromosome mutations – affect whole chromosome Mutations may be Chromosome mutations – affect whole chromosome Ex. Trisomy 21 aka Down Syndrome Gene mutations – affect a single gene

Types of gene mutations Substitution - Substitute 1 nucleotide base for another Insertion - Add one or more extra nucleotides Deletion- Remove 1 or more nucleotides

Substitutions are known as point mutations Possibly change 1 amino acid May be “silent” May introduce stop codon Insertion/Deletion result in Frameshift Can change the whole reading frame of the mRNA

Mutations may be Helpful Harmful Neutral Give organism new trait beneficial to their survival Harmful Make them less likely to survive Neutral No affect

Evolution Link: Mutations are the ultimate source of variation