Changing the world one nitrogenous base at a time…

Slides:



Advertisements
Similar presentations
AP Biology Human Genetic Diseases
Advertisements

Mutations.
Human Genetic Diseases
Mutations Changes to DNA
Mutations Changes to DNA
AP Biology Chapter 17 Mutations: Point, Frameshift and Examples.
Mutations
Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,
Translation from nucleic acid language to amino acid language Draw 7 boxes on your paper.
Regents Biology Mutations Changes to DNA.
Human Genetic Diseases
Regents Biology Mutations Changes to DNA.
Mutations Changes to DNA Mutations Changes to DNA are called mutations – change the DNA – changes the mRNA – may change protein – may change.
Protein Synthesis Transcription and Translation RNA Structure Like DNA, RNA consists of a long chain of nucleotides 3 Differences between RNA and DNA:
Human Genetic Diseases & Pedigrees Pedigree analysis Pedigree analysis reveals Mendelian patterns in human inheritance – Data mapped on a family.
Regents Biology Mutations Changes to DNA.
AP Biology Human Genetic Diseases
Regents Biology Mutations Changes to DNA.
Human Genetic Diseases (Ch. 15)
Human Genetic Diseases
Human Genetic Diseases
Studying Inheritance in Humans
Human Genetic Diseases
Human Genetic Diseases
What does a mutation look like?
Mutations.
Unit 7: Molecular Genetics
Mutations
Honors Biology Chapter 12
Human Genetic Diseases
Chapter 13: RNA and Protein Synthesis
Aim: Mutations Enter Date Warm-up: HW:.
Mutations
Mutations
Mutations
Mutations
Mutations Changes to DNA
Human Genetic Diseases
Human Genetic Diseases
Mutations
Mutations
Mutations Changes to DNA
Human Genetic Diseases
End of Ch. 17: Mutations
Mutations
Mutations.
From DNA to Proteins.
Human Genetic Diseases
Human Genetic Diseases
Mutations Changes to DNA
Mutations
Mutations Changes to DNA
Human Genetic Diseases
Unit 7: Molecular Genetics
Human Genetic Diseases
Mutations.
Mutations
Mutations
Mutations
Review: Can you tell the story of protein synthesis?
Mutations
Mutations Changes to DNA
Mutations
Mutations
Human Genetic Diseases
Presentation transcript:

Changing the world one nitrogenous base at a time… MUTATIONS! AHHH! Changing the world one nitrogenous base at a time…

TRANSCRIPTION AND TRANSLATION Genes code for proteins through… transcription translation

Mutations are changes in DNA sequences changes to the order of A, T, C & G different order = different amino acid in protein different protein structure = different protein function BB Bb bb

TACGCACATTTACGTACGCGG GENES Genes code for proteins the order of A, T, C & G Proteins create traits DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC aa protein trait

MUTATIONS Point mutations single base change silent mutation missense no amino acid change redundancy in code missense change amino acid nonsense change to stop codon

MUTATIONS – Sickle Cell Anemia What kind of mutation? Missense!

MUTATIONS – Sickle Cell Anemia Primarily Africans recessive inheritance pattern strikes 1 out of 400 African Americans

MUTATIONS Frameshift adding base(s) shift in the reading frame changes everything “downstream” insertions adding base(s) deletions losing base(s) Where would this mutation cause the most change: beginning or end of gene?

FRAMESHIFT MUTATIONS Deletion Insertion THERATANDTHECATATETHEREDBAT THERTANDTHECATATETHEREDBAT THERTANDTHECATATETHEREDBAT THERTANDTHECATATETHEREDBAT THERTANDTHECATATETHEREDBAT Insertion THERAATANDTHECATATETHEREDBAT THERAATANDTHECATATETHEREDBAT THERAATANDTHECATATETHEREDBAT

MUTATIONS – Cystic Fibrosis Primarily whites of European descent strikes 1 in 2500 births 1 in 25 whites is a carrier (Aa) normal allele codes for a membrane protein that moves Cl- across cell membrane mutant channel limit movement of Cl- (& H2O) across cell membrane thicker & stickier mucus coats cells mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections without treatment children die before 5; with treatment can live past their late 20s Cystic fibrosis is an inherited disease that is relatively common in the U.S. Cystic fibrosis affects multiple parts of the body including the pancreas, the sweat glands, and the lungs. When someone has cystic fibrosis, they often have lots of lung problems. The cause of their lung problems is directly related to basic problems with diffusion and osmosis in the large airways of the lungs. People without cystic fibrosis have a small layer of salt water in the large airways of their lungs. This layer of salt water is under the mucus layer which lines the airways. The mucus layer in the airways helps to clear dust and other inhaled particles from the lungs.

bacteria & mucus build up mucus secreting glands Effect on Lungs Chloride channel transports chloride through protein channel out of cell Osmotic effects: H2O follows Cl- normal lungs airway Cl- Cl- channel H2O cells lining lungs cystic fibrosis Cl- In people without cystic fibrosis, working cystic fibrosis proteins allow salt (chloride) to enter the air space and water follows by osmosis. The mucus layer is dilute and not very sticky. In people with cystic fibrosis, non-working cystic fibrosis proteins mean no salt (chloride) enters the air space and water doesn't either. The mucus layer is concentrated and very sticky. People with cystic fibrosis have lung problems because: Proteins for diffusion of salt into the airways don't work. (less diffusion) Less salt in the airways means less water in the airways. (less osmosis) Less water in the airways means mucus layer is very sticky (viscous). Sticky mucus cannot be easily moved to clear particles from the lungs. Sticky mucus traps bacteria and causes more lung infections. Therefore, because of less diffusion of salt and less osmosis of water, people with cystic fibrosis have too much sticky mucus in the airways of their lungs and get lots of lung infections. Thus, they are sick a lot. H2O bacteria & mucus build up thickened mucus hard to secrete mucus secreting glands

What’s the value of mutations?