Protein Synthesis Making Proteins 2009-2010

copyright cmassengale DNA  RNA  Protein Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein Eukaryotic Cell copyright cmassengale

DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded

copyright cmassengale Amino Acid Structure copyright cmassengale

copyright cmassengale DNA Begins the Process DNA is found inside the nucleus Proteins, however, are made in the cytoplasm of cells by organelles called ribosomes Ribosomes may be free in the cytosol or attached to the surface of rough ER copyright cmassengale

copyright cmassengale Starting with DNA DNA ‘s code must be copied and taken to the cytosol In the cytoplasm, this code must be read so amino acids can be assembled to make polypeptides (proteins) This process is called PROTEIN SYNTHESIS copyright cmassengale

Part I: Transcription Making mRNA from DNA DNA strand is the template (pattern) pairing bases U : A G : C Enzyme RNA polymerase

copyright cmassengale Transcription Promoters are regions on DNA that show where RNA Polymerase must bind to begin the Transcription of RNA Called the TATA box Specific base sequences act as signals to stop Called the termination signal copyright cmassengale

Pairing bases of DNA & RNA Double stranded DNA unzips with RNA polymerase T G G T A C A G C T A G T C A T C G T A C C G T

Pairing bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Pairing bases of DNA & RNA Pair RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Pairing bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

copyright cmassengale RNA Polymerase copyright cmassengale

Remember the Complementary Bases On DNA: A-T C-G On RNA: A-U copyright cmassengale

copyright cmassengale Question: What would be the complementary RNA strand for the following DNA sequence? DNA 5’-GCGTATG-3’ copyright cmassengale

copyright cmassengale Answer: DNA 5’-GCGTATG-3’ RNA 3’-CGCAUAC-5’ copyright cmassengale

Part II: mRNA Processing After the DNA is transcribed into RNA, editing must be done to the nucleotide chain to make the RNA functional Introns, non-functional segments of DNA are snipped out of the chain copyright cmassengale

copyright cmassengale mRNA Editing Exons, segments of DNA that code for proteins, are then rejoined by the enzyme ligase A guanine triphosphate cap is added to the 5” end of the newly copied mRNA A poly A tail is added to the 3’ end of the RNA The newly processed mRNA can then leave the nucleus copyright cmassengale

Result of Transcription New Transcript Tail CAP copyright cmassengale

copyright cmassengale mRNA Transcript mRNA leaves the nucleus through its pores and goes to the ribosomes copyright cmassengale

cytoplasm protein nucleus ribosome U C A G trait

copyright cmassengale Part III:Translation Translation is the process of decoding the mRNA into a polypeptide chain Ribosomes read mRNA three bases or 1 codon at a time and construct the proteins copyright cmassengale

How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA mRNA U C A G aa

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein Codon = block of 3 mRNA bases

The mRNA code For ALL life! Code has duplicates Start codon strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

copyright cmassengale The Genetic Code Use the code by reading from the center to the outside Example: AUG codes for Methionine copyright cmassengale

copyright cmassengale Name the Amino Acids GGG? UCA? CAU? GCA? AAA? copyright cmassengale

copyright cmassengale Step 1- Initiation mRNA transcript start codon AUG attaches to the small ribosomal subunit Small subunit attaches to large ribosomal subunit mRNA transcript copyright cmassengale

copyright cmassengale Ribosomes Large subunit P Site A Site mRNA A U G C Small subunit copyright cmassengale

copyright cmassengale Step 2 - Elongation As ribosome moves, two tRNA with their amino acids move into site A and P of the ribosome Peptide bonds join the amino acids copyright cmassengale

copyright cmassengale Initiation 2-tRNA G aa2 A U 1-tRNA U A C aa1 anticodon A U G C U A C U U C G A hydrogen bonds codon mRNA copyright cmassengale

copyright cmassengale Elongation 3-tRNA G A aa3 peptide bond aa1 aa2 1-tRNA 2-tRNA anticodon U A C G A U A U G C U A C U U C G A hydrogen bonds codon mRNA copyright cmassengale

copyright cmassengale aa1 peptide bond 3-tRNA G A aa3 aa2 1-tRNA U A C (leaves) 2-tRNA G A U A U G C U A C U U C G A mRNA Ribosomes move over one codon copyright cmassengale

copyright cmassengale peptide bonds 4-tRNA G C U aa4 aa1 aa2 aa3 2-tRNA 3-tRNA G A U G A A A U G C U A C U U C G A A C U mRNA copyright cmassengale

copyright cmassengale peptide bonds 4-tRNA G C U aa4 aa1 aa2 aa3 2-tRNA G A U (leaves) 3-tRNA G A A A U G C U A C U U C G A A C U mRNA Ribosomes move over one codon copyright cmassengale

copyright cmassengale peptide bonds U G A 5-tRNA aa5 aa1 aa2 aa4 aa3 3-tRNA 4-tRNA G A A G C U G C U A C U U C G A A C U mRNA copyright cmassengale

copyright cmassengale peptide bonds U G A 5-tRNA aa5 aa1 aa2 aa3 aa4 3-tRNA G A A 4-tRNA G C U G C U A C U U C G A A C U mRNA Ribosomes move over one codon copyright cmassengale

copyright cmassengale aa5 aa4 aa199 Termination aa3 primary structure of a protein aa200 aa2 aa1 terminator or stop codon 200-tRNA A C U C A U G U U U A G mRNA copyright cmassengale

End Product –The Protein! The end products of protein synthesis is a primary structure of a protein A sequence of amino acid bonded together by peptide bonds aa1 aa2 aa3 aa4 aa5 aa200 aa199 copyright cmassengale

copyright cmassengale Messenger RNA (mRNA) A U G C mRNA start codon codon 2 codon 3 codon 4 codon 5 codon 6 codon 7 codon 1 methionine glycine serine isoleucine alanine stop codon protein Primary structure of a protein aa1 aa2 aa3 aa4 aa5 aa6 peptide bonds copyright cmassengale

copyright cmassengale Transfer RNA (tRNA) Clover-leaf shape Single stranded molecule with attachment site at one end for an amino acid Opposite end has three nucleotide bases called the anticodon copyright cmassengale

copyright cmassengale Transfer RNA amino acid attachment site U A C anticodon copyright cmassengale

copyright cmassengale Codons and Anticodons The 3 bases of an anticodon are complementary to the 3 bases of a codon Example: Codon ACU Anticodon UGA UGA ACU copyright cmassengale

copyright cmassengale Transcription Transcription occurs when DNA acts as a template for mRNA synthesis. Translation occurs when the sequence of the mRNA codons determines the sequence of amino acids in a protein. Translation copyright cmassengale

copyright cmassengale Ribosomes Made of a large and small subunit Composed of rRNA (40%) and proteins (60%) Have two sites for tRNA attachment --- P and A copyright cmassengale