Sequences and their Properties

Nucleotides DNA A, T, G, C RNA A, U, G, C

Annealing Two opposing forces affect annealing Nucleic acids can base pair with their reverse complement sequence Two opposing forces affect annealing Hydrogen bonds favours annealing Phosphate groups favours denaturation

Annealing-Melting Point (Tm) The Tm is the temperature at which 50% of the nucleic acid molecules are in a single stranded state (or double stranded) The Tm is a function of: Percentage G:C Ionic composition of the environment The percentage of complementarity Estimate of Tm for oligos =2(#A:T) + 4(#G:C)

Tm Vs percentage G:C % Double stranded Temperature (C) (38%) G+C (52%) 70 80 90 100 50 100 (38%) G+C (52%) (58%) (66%) % Double stranded Temperature (C)

Tm Vs Conc. of Positive Ions 70 80 90 100 (0.1M NaCl) 50 100 (0.2M NaCl) (0.5M NaCl) % Double stranded Temperature (C)

Tm Vs percentage of complementarity 70 80 90 100 (25%) 50 100 (50%) (100%) % Double stranded Temperature (C)

Stringency Percentage of complementarity required to allow the formation of stable duplexes The Tm influences the stringency conditions required to allow annealing A high stringency requires a high level of complementarity GATCCGGTTATTA vs GATCCGGTTATTA CTAGGCCAATAAT CTTGGACGATAAT

Parameters that influence stringency  [salt] = High stringency  Temperature = High stringency  [salt] = ?  Temperature = ?

Hybridization Stringency

Genetics and Mutations

Definitions Locus Gene The position of a coding or non coding genetic element Gene All the nucleotide elements required for the expression of a transcript Promoter, ORF, introns, exons, etc.

Genetic Definitions (Cont’d) Allele Version of a genetic element at a given locus Everyone necessarily has two alleles for each genomic locus The two alleles may be the same Homozygotes The two alleles may be different Heterozygote A population of individuals may have multiple alleles of a genomic locus

Genetic Definitions (Cont’d) Genotype: Nucleic acid sequence responsable for the phenotype Physical detection by molecular techniques Phenotype: Trait that can be distinguished resulting from a genotype Several different genotypes may have the same phenotype

The Differences Between individuals of the same sex <0.5% Between humans and chimpanzes <2%

Point Mutations Missense - Neutral Synonymous/Silent : Base change that does NOT change the amino acid coded Ex. AGG → CGG both Arg Missense - Non-Synonymous - Conserved: Base change results in a different but similar amino acid Same charge and shape Ex. AAA → AGA Lys to Arg both basic amino acids

Point Mutations Missense - Non-Synonymous-Semi conserved: Base change resulting in a different but similar amino acid Same shape but different charge Ex. CGC → CUC Arg (Polar) to Leu (Non-polar) Missense - Non-Synonymous - Non conserved Base change resulting in totally different amino acids Different shape different charge

Point Mutations Nonsense point mutation: Base change resulting in the creation of a premature stop codon within the ORF Causes premature translation termination Truncated protein Indel – Insertion or deletion of a single base within the ORF Changes reading frame Changes protein sequence May cause premature termination

Molecular Markers Characteristics of the nucleotide sequence The phenotype often corressponds to a specific genotype Restriction polymorphisms (RFLP) Length polymorphisms (VNTR) Variable number of tandem repeats Single nucleotide polymorphisms (SNP)

Length Polymorphisms - RFLP Based on the presence or absence of a restriction site at a given poistion Ex. The enzyme EcoR1 recognizes and cleaves the sequence: GAATTC A single base mutation abolishes the site GAGTTC

Detection of Genomic RFLP 1 2 Polymorphism A B E A+B * E Genome 1 Genome 2 2 possible phenotypes 2 alleles can be distinguished Several possible genotypes 21

Detection of RFLP by PCR

Length Polymorphisms Minisatellites and Microsatellites: Sequences repeated in tandem Highly variable number of repetitions between individuals; thus several alleles Length polymorphisms Molecular phenotype=Genotype   Minisatellites Low distribution throughout the genome Mostly found within telomeres Microsatellites: High distribution throughout the genome VNTR

Length polymorphisms - VNTRs The number of repetitions = different lengths = different alleles = different genotypes = different molecular phenotypes

Length Polymorphisms - VNTR DNA Region where tandem copies of di-, tri- or tetra repeated units are located Examples: Dinucleotide repeat GTGTGTGTGTGT…… Trinucléotide repeat ACGACGACGACG…… Tetranucléotide repeat TATCTATCTATC……

VNTR (Cont’d) Highly variable number of repetitions individuals Thus several alleles within a population CA Allele 1 Allele 2 Allele 3 Different fragment lengths would be generated by a digestion at the indicated positions

Detection of VNTR by PCR AGCTGCTTAATGCTGCTGCTGCTGCTGCTGCATAACATTGC Individual 1 AGCGGCTTAATGCTGCTGCATAACATTGC Individual 2 1 2 Amplification & gel separation 27

Biometrics

VNTR Profile From whom does the blood come from? 29

VNTR Profile Bob Luc Paul Tom Marc Who is Bob’s father? 30

Determing number of loci Determine both extremes In this case 8 and 13 Dertermine max and min for each extreme In the case of 8: max 8, min 4 In the case of 13: max 13, min 7 Determine range 7-8 loci What is maximum number of homozygous loci if number of bands is 13?