Biotechnology 2007-2008

A Brave New World

human genome 3.2 billion bases TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT human genome 3.2 billion bases

Biotechnology: Recombinant DNA Insert a new gene So it makes a new protein… And has a new trait! transcription translation DNA RNA protein trait

Bacteria helpers Bacteria are opportunists Bacteria have plasmids pick up foreign DNA wherever it may be hanging out incorporate the DNA bits into their own chromosome Bacteria have plasmids Small circles of “naked” DNA in bacteria

How can plasmids help us? A way to get genes into bacteria easily insert new gene into plasmid insert plasmid into bacteria bacteria now expresses new gene bacteria make new protein transformed bacteria gene from other organism recombinant plasmid plasmid cut DNA + glue DNA

How is this useful for us? Insert human gene into a bacteria = get it to make a human protein! cut DNA with enzymes gene we want like what? …insulin …HGH …lactase cut plasmid DNA with the same enzyme Cut DNA? DNA scissors? ligase insert “gene we want” into plasmid... “glue” together recombinant plasmid

The code is universal Since all living organisms… use the same DNA use the same code book read their genes the same way Strong evidence for a single origin in evolutionary theory.

Grow bacteria…make more transformed bacteria gene from other organism + recombinant plasmid vector plasmid grow bacteria harvest (purify) protein

Uses of genetic engineering Genetically modified organisms (GMO) enabling plants to produce new proteins Protect crops from insects: BT corn corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn) Extend growing season: fishberries strawberries with an anti-freezing gene from flounder Improve quality of food: golden rice rice producing vitamin A improves nutritional value For example, a transgenic rice plant has been developed that produces yellow grains containing beta-carotene. Humans use beta-carotene to make vitamin A. Currently, 70% of children under the age of 5 in Southeast Asia are deficient in vitamin A, leading to vision impairment and increased disease rates.

Transformed vertebrates Green with envy?? Jelly fish “GFP” Transformed vertebrates

Cut, Paste, Copy… Word processing metaphor… cut paste copy restriction enzymes paste ligase copy plasmids bacterial transformation

I’m a very special pig! Got any Questions? 2007-2008