Unit 7: Molecular Genetics 7.7 Mutations

Mutations Mutations: Changes to DNA changes the DNA changes the mRNA may change protein may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

Mutations An organisms traits are based on their DNA sequence because: DNA sequence  amino acid sequence  protein shape  function  Trait If there are changes in the DNA sequence, it can lead to changes in traits.

Types of mutations Changes to the letters (A,C,T,G bases) in the DNA point mutation: change to ONE letter (base) in the DNA (substitution) may cause change to protein, may not frameshift mutation: addition or deletion of a letter (base) in the DNA sequence. both of these shift the DNA so it changes how the codons are read

Point Mutations- Examples One base change can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN

Point Mutations- Examples Sometimes the amino acid changes AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? DEPENDS… AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop

Misshapen sickle cells Sickle cell anemia Hemoglobin protein in red blood cells strikes 1 out of 400 African Americans limits activity, painful & may die young Normal round cells Misshapen sickle cells Only 1 out of 146 amino acids

Frameshift Mutations- Examples Add or delete one or more bases changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this change the sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN

Frameshift Mutations- Examples Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA

Frameshift Mutations- Examples Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this change the protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA

Cystic fibrosis Broken salt channel in cells strikes 1 in 2500 white births gene codes for a protein channel that allows salt to flow across cell membrane broken protein doesn’t work as channel doesn’t allow salt out of cell, so water doesn’t flow out either thicker & stickier mucus coating around cells mucus build-ups in lungs & causes bacterial infections destroys lung function without treatment children die before 5; with treatment can live past their late 20s Cystic fibrosis is an inherited disease that is relatively common in the U.S. Cystic fibrosis affects multiple parts of the body including the pancreas, the sweat glands, and the lungs. When someone has cystic fibrosis, they often have lots of lung problems. The cause of their lung problems is directly related to basic problems with diffusion and osmosis in the large airways of the lungs. People without cystic fibrosis have a small layer of salt water in the large airways of their lungs. This layer of salt water is under the mucus layer which lines the airways. The mucus layer in the airways helps to clear dust and other inhaled particles from the lungs.

Deletion leads to Cystic fibrosis Loss of one amino acid!

Types of mutations Changes to the letters (A,C,T,G bases) in the DNA Stop mutation: causes the protein to stop forming prematurely or causes the continual translation beyond where the stop should be.

Stop Mutation- Example AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Really destroyed that protein! AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop

Types of mutations Changes to the letters (A,C,T,G bases) in the DNA Chromosomal mutation: Changes in the number or structure of chromosomes Silent mutation: Mutations in the DNA that do not significantly alter the expression of genes

Silent mutation- Example AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop The code has repeats in it! Does this change the protein? Why not? AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop

Causes of Mutations DNA fails to copy accurately External agents cause DNA to break down Examples: Environmental toxins, radiation, smoke, etc.

Questions Identify the following types of mutations: Original gene sequence: CTTAGCATGC Mutation A: CTAGCATGC Mutation B: CTTAGGCATGC Mutation C: CTTAGTATGC