12.4 Mutations and Gene Regulation

Slides:

Advertisements

Similar presentations

Any change in the DNA base sequence is called a mutation

Advertisements

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Mutations. Definition mutation A mutation is a change in an organism’s DNA – Silent mutations are changes that do not result in a change to the organisms.

SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

A mutation is a change in an organism’s DNA.

12.4 MUTATIONS I. Kinds of Mutations

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.

Mutations. Change / alteration to the DNA of an organism They may be good, bad or have no effect A plant that can better tolerate the cold (GOOD) A change.

What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.

12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.

Reality Science Fiction! Just silly.. 1. Some mutations affect a single gene, while others affect an entire chromosome. 2. A mutation is a change in an.

MUTATIONS No this can’t happen with just mutations.

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

8.7 Mutations A mutation is a change in an organism’s DNA. May occur during replication. May affect a single gene, or an entire chromosome May or may not.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

A mutation is a change in an organism’s DNA.

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,

Copyright Pearson Prentice Hall

Mutations Add to Table of Contents – p. 14

Mutations TSW identify and describe the various types of mutations and their effects.

To be successful today…

Kinds of Mutations Point Mutation Occur at a single point in the DNA

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Some mutations affect a single gene, while others affect an entire chromosome.

A ____________ is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mutations Chapter 8.7.

Draw a conclusion from this graph for both the red and blue line

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mutation Notes.

Objective: Explain the main types of mutations

Copyright Pearson Prentice Hall

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Presentation transcript:

12.4 Mutations and Gene Regulation Mutation - Change in DNA sequence Cause of Mutation - A mutagen is a factor that results in a change in DNA

12.4 Mutations and Gene Regulation What can happen as a result of a mutation? Bad mutation = disease/death Good mutation = beneficial adaptation (opposable thumbs, X-MEN) Neutral = no visible change

12.4 Mutations and Gene Regulation WE ALL UNDERGO MUTATIONS!

12.4 Mutations and Gene Regulation Types of mutations – Point Mutations Deletion – ATGCAT (delete G) ATCAT Insertion – ATGCAT (add A to the middle) ATGCAAT With Deletions and Insertions, the reading frame shifts. In some cases, the old amino acid no longer exists and a new amino acid is made. Substitution – ATGCAT (substitute A for G) ATACAT In some cases with a Substitution, a new amino acid is made and the old amino acid no longer exists.

12.4 Mutations and Gene Regulation

12.4 Mutations and Gene Regulation

12.4 Mutations and Gene Regulation

12.4 Mutations and Gene Regulation Sex cell mutations - Occurs in the sperm/egg Effects the offspring Down Syndrome can be acquired this way in addition to nondisjunction. (Ch. 11) Body cell mutations - Occurs in body cells Effects the organism Cancer is an example.

12.4 Mutations and Gene Regulation