Sequenciamento de DNA.

Slides:



Advertisements
Similar presentations
Diagnosis with PCR This is a preparation of DNA. We zoomed in a portion of a gene. We know that two primers, Forward and Reverse, will hybridize at specific.
Advertisements

Principles of DNA Sequencing Terry Kotrla, MS, MT(ASCP)BB Spring 2010.
Intro to DNA Sequencing
Cycle Sequencing. Broad and Long Term Objective To characterize a single clone from an Emiliania huxleyi cDNA library using sequence analysis To characterize.
DNA Sequencing. DNA sequencing … ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT CTAGCTAGACTACGTTTTA TATATATATACGTCGTCGT ACTGATGACTAGATTACAG ACTGATTTAGATACCTGAC.
DNA Sequencing How do you do it?. DNA Sequencing DNA sequencing – used to determine the actual DNA sequence of an organism. Using a computer, one can.
DNA Sequencing. ? ? DNA extraction PCR Gel electrophoresis Insect identification ACAGATGTCTTGTAATCCGGC CGTTGGTGGCATAGGGAAAG GACATTTAGTGAAAGAAATTG ATGCGATGGGTGGATCGATG.
DNA Sequencing Kabi R. Neupane, Ph.D. Leeward Community College ABE Workshop 2006.
DNA Sequencing.
Emily Buckhouse. Nitrogenous Bases Nucleosides  Base linked to a 2-deoxy-D-ribose at 1’ carbon Nucleotides Nucleosides with a phosphate at 5’ carbon.
Sanger-Coulson Dideoxynucleotide Sequencing Kwamina Bentsi-Barnes Deisy Mendoza Jennifer Aoki Lecture 10/30/00 Best printed in color for clarity.
7.1 cont’d: Sanger Sequencing SBI4UP MRS. FRANKLIN.
DNA Sequencing. * Sequencing means finding the order of nucleotides on a piece of DNA. * Nucleotide order determines amino acid order, and by extension,
DNA Sequencing Chemical Method and Termination Method Shaila Ahmed 02/13/04 BICM
Automated DNA Sequencing LECTURE 7: Biotechnology; 3 Credit hours Atta-ur-Rahman School of Applied Biosciences (ASAB) National University of Sciences and.
1.) DNA Extraction Follow Kit Grind sample Mix with solution and spin Bind, Wash, Elute.
6.3 Advanced Molecular Biological Techniques 1. Polymerase chain reaction (PCR) 2. Restriction fragment length polymorphism (RFLP) 3. DNA sequencing.
Denaturácia a renaturácia RNázy A Nobelova cena z chémie v roku 1972 za práce o zvinovaní proteínov.
DNA sequencing: Importance Basic blueprint for life; Aesthetics. Gene and protein. –Function –Structure –Evolution Genome-based diseases- “inborn errors.
Applications of DNA technology
Genome sequencing Haixu Tang School of Informatics.
Genomic sequencing in Plants R.Sakthivel
A Lot More Advanced Biotechnology Tools (Part 1) Sequencing.
1 Chapter 2: DNA replication and applications DNA replication in the cell Polymerase chain reaction (PCR) Sequence analysis of DNA.
DNA Sequencing Scenario
How DNA Sequence Is Determined? Polyacrylamide Gel Electrophoresis ATC 32 P AT 32 P A T A G C T A C G ATCG 32 P ATCGA 32 P ATCGAT 32 P ATCGATC 32 P ATCGATCG.
Sequencing DNA 1. Maxam & Gilbert's method (chemical cleavage) 2. Fred Sanger's method (dideoxy method) 3. AUTOMATED sequencing (dideoxy, using fluorescent.
DNA Sequencing.
Biotechniques. DNA sequencing To determine the base sequence of DNA fragments. DNA replicated into smaller fragments incorporating fluorescent tags Fragments.
6.3 Advanced Molecular Biological Techniques 1. Polymerase chain reaction (PCR) 2. Restriction fragment length polymorphism (RFLP) 3. DNA sequencing.
Sequencing by the Sanger Dideoxynucleotide Chain Termination Method 1. Prepare replication template denature, add synthetic primer, promote annealing TAGGCGA.
©1999 Timothy G. Standish DNA Sequencing Timothy G. Standish, Ph. D.
DNA Sequencing Mimi Chen & Joanne Kim
DNA Sequencing Sanger Di-deoxy method of Sequencing Manual versus Automatic Sequencing.
DNA sequencing reaction DNA sequencing reactions are just like the PCR reactions for replicating DNA The reaction mix includes the template DNA, free.
DNA Sequencing Hunter Jones, Mitchell Gage. What’s the point? In a process similar to PCR, DNA sequencing uses a mixture of temperature changes, enzymes.
DNA Sequencing A population of DNA fragments is generated. –One end is common to all fragments (the 5’ end of the sequencing primer). –The other end terminates.
AMPLIFYING DNA A.Recombinant DNA B.Polymerase Chain Reaction (PCR) (animation)
핵산 염기서열 분석(DNA SEQUENCING)
28-1 William H. Brown Beloit College William H. Brown Christopher S. Foote Brent L. Iverson Eric Anslyn Chapter.
DNA sequencing DNA sequencing is the process of determining the precise order of nucleotides within a DNA molecule. It includes any method or technology.
DNA Sequencing BCH 446.
One method of rapidly analyzing and comparing DNA is gel electrophoresis. Gel electrophoresis separates macromolecules - nucleic acids or proteins - on.
Genomics Sequencing genomes.
DNA Sequencing Techniques
Di-deoxynucleotide Chain Termination
Joseph E. Conley, Alex J. Meisel, and James J
Today’s Title: CW: DNA manipulation – separating and probing
DNA Sequencing.
Genetic Research and Biotechnology
Sequencing Technologies
AMPLIFYING AND ANALYZING DNA.
DNA Technology.
DNA Sequencing Chemical Method and Termination Method
DNA sequencing Direct determination of nucleotide sequence
DNA Sequence Determination (Sanger)
Sequencing and Copying DNA
DNA Sequencing A population of DNA fragments is generated.
DNA Sequencing A population of DNA fragments is generated.
DNA Sequencing A population of DNA fragments is generated.
A B - deoxynucleotide (dNTP) dideoxynucleotide (ddNTP)
DNA and the Genome Key Area 8a Genomic Sequencing.
5. DNA Sequencing pp
Molecular Biology lecture -Putnoky
Polymerase Chain Reaction (PCR) & DNA SEQUENCING
Plant Biotechnology Lecture 2
DNA Sequencing.
SBI4U0 Biotechnology.
Excision of the Drosophila Mariner Transposon Mos1
Polymerase Chain Reaction (PCR) & DNA SEQUENCING
Presentation transcript:

Sequenciamento de DNA

Primer

1 A 2 5’ 3’ 5’ 3’ Sanger’s Method: How Terminated OH PO4 H 5’ P R ddNTP Terminated Normal Linking 3 4 5 6 A PO4 2- H 3’ 5’ 2 Phosphodiester bond 3’ dideoxynucleotide Can not react

How DNA Sequence Is Determined? DNA fragments having a difference of one nucleotide can be separated on gel electrophoresis Polyacrylamide Gel Electrophoresis T A G C ATCGATCGAT 32P ATCGATCGA 32P ATCGATCG 32P ATCGATC 32P ATCGAT 32P ATCGA 32P G ATCG 32P C ATC 32P T AT 32P A A 32P But these bands can’t tell us the identity of the terminal nucleotides If those band with the same terminal nucleotide can be grouped, then it is possible to read the whole sequence

How to Obtain DNA Fragments Maxam-Gilbert's Method: Chemical method Destroy → Cleavage 32P ATCGATCG AT 32P ATCGATCGAT 32P ATCG ATCGAT Destroy → Cleavage Non-radioactive (invisible) Specific Reaction to G Sanger's Method: 32P Biosynthetic method Keep on going ATCGA 32P A,T,C,G A Analogue TAGCTAGCTA ATCG Producing various fragments or TAGCTAGCTA STOP Terminated Template ATCG A TAGCTAGCTA