Mutations Hollywood’s images of mutation.

Slides:



Advertisements
Similar presentations
Mutations Hollywood’s images of mutation. Mutations Hollywood’s images of mutation.
Advertisements

Mutations Hollywood’s images of mutation.
Mutations 1.
February 23, 2009 Objective: Discuss the effects of nondisjunction
Mutations.
Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.
DNA Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA.
Human Genetic Mutations
Mutations. What Are Mutations?  Changes in the nucleotide sequence of DNA  May occur in somatic cells (aren’t passed to offspring)  May occur in gametes.
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
MUTATIONS.
Changes in DNA that affect genetic information
Mutations
DNA Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA.
Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.
Chromosomal Mutations When Good Meiosis Goes Bad.
Human Genetic Mutations
Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.
Biology Mistakes in the Genetic Machine. Terms for Section 6 Gene regulation Mutation Point mutation Frameshift mutation Mutagen.
Mutations  Hollywood’s images of mutation. Mutations  Actual Mutations in fruit flies.
Mutations (p. 307) Mutations are changes in the genetic material. Mutations may be genetic mutations or chromosomal mutations.
Genetic Mutation. Mutation Greatest source of genetic diversity A change in the sequence of nucleotides of a gene. Some changes to the DNA will alter.
Mutations.
Don’t let this happen to you!!
Changes in DNA that affect genetic information
Mutation Notes: Chapter 11.
May occur in somatic cells (aren‘t passed to offspring)
Mutations Aka, Pobody’s Nerfect.
Genetic Abnormalities
Mutations.
Mutations When Good DNA Goes Bad
Changes in DNA that affect genetic information
Mutations.
Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,
Mutations.
Mutations.
Mutations.
Changes in DNA that affect genetic information
Warm Up 1. Place DNA Extraction lab into the basket located at the front 2. Pick up your plicker card from me 3. In your warm up notebook, write down.
Nondisjunction GT pg (Section 13.10) chromosomal mutation, p.408 (Last paragraph)?? Reg- p. 401, top 374.
Chromosomes, Genes, Alleles and Mutations
Copy 120 RNA gizmo 121. Sickle Cell Mutation notes
Mutations.
Chapter 13: Genes & Chromosomes
Human Genetic Mutations
Don’t let this happen to you!!
Mutations.
Chromosomes & Karyotypes
Mutations.
MUTATIONS.
Mutations.
Mutations Hollywood’s images of mutation.
Cell Divisions & Mutations
Mutations A mutation is any change in the DNA sequence.
Chromosome Mutations Basic review of mutations and some inherited conditions Warm Up: Define MUTATION in your compbook or on a piece of paper.
Mutations.
Don’t let this happen to you!!
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
DNA is composed of nucleotides
Mutations.
Mutations A mutation is any change in the DNA sequence.
Don’t let this happen to you!!
DNA: The Blueprints For Life
Mutations.
Changes in DNA that affect genetic information
Mutations 1) Gene Mutations = change in pattern of DNA bases
Mutations.
Don’t let this happen to you!!
Mutations: Changes in Genes
Presentation transcript:

Mutations Hollywood’s images of mutation

Mutations Actual Mutations in fruit flies

What is a mutation? A mutation is any change in a cell’s DNA A mutation can occur in an individual gene - results in a single changed protein - cystic fibrosis a mutation in the protein that makes a type of ion channels in cell membrane - bacterial resistance to antibiotics is an example of a beneficial gene mutation

What is a mutation continued A mutation can occur in a chromosome - a chromosome contains many genes - chromosomal mutations affect many proteins If a mutation occurs in a sex cell, the mutation will be passed to offspring Examples: Down Syndrome Edward’s Syndrome Cri-du-Chat

What Causes Mutations? Environment: Can be caused by mutagens- a physical or chemical cause of mutation. Examples: UV light, radiation, drugs, and benzene. Mutagens are often also carcinogens – anything that causes cancer Can be natural, random events. - mutations occur in 1/100,000 DNA replications (DNA mistakes) Mutations do not have to be bad (evolution)

Gene Mutations

Point Mutations A single nucleotide is altered. Can change one amino acid in a protein Milk – Mile GGACAATCA GGACCATCA proline -valine-serine proline-glycine-serine ***ONLY ONE AMINO ACID IS AFFECTED AS A RESULT OF POINT MUTATIONS!***

Frameshift Mutations A nucleotide is either inserted or deleted from a gene. -all of the triplets from the point of mutation onward will be changed

Frameshift Mutations Insertion An insertion occurs when a nucleotide is added to a gene Example: A nucleotide is inserted The fat cat ate the rat The faa tca tat eth era t -the extra nucleotide shifts all of the triplets that follow

Frameshift Mutations Deletions A deletion occurs when a nucleotide is removed from a gene. Example: A nucleotide is removed The fat cat ate the rat Thf atc ata tet her at

proline -valine-serine arginine-cysteine-stop Deletion Insertion GGACAATCA GCGACAATCA proline -valine-serine arginine-cysteine-stop Deletion GGACAATCA GGAAATCA proline -valine-serine proline-leucine

Deletion Example: Cri du chat syndrome Due to a deletion of part of the short arm of chromosome 5 Occurrence: 1/50,000 births Crying babies sound like cats; mental disability Death by about 4 years

Chromosome Mutations

KARYOTYPES Kary = nucleus Karyotype = chart of metaphase chromosome pairs arranged according to length and location of the centromere Used to pinpoint unusual chromosome numbers in cells

Nondisjunction Sometimes during meiosis, the homologous chromosomes fail to separate properly This can result in two types of chromosomal mutations: (1) trisomy (have an extra set of chromosomes) (2) monosomy (missing one set of chromosomes)

XYY Syndrome

Turner’s Syndrome

Down’s Syndrome

Klinefelter syndrome: 47, XXY males, sterile, feminine body characteristics. Normal intelligence.

Edward’s syndrome (trisomy 18):occurs in 1:6000 or 1:8000 live births; very few survive birth.