Mutations Ms MacCormack Fall 2018.

Slides:



Advertisements
Similar presentations
Human Genetic Mutations
Advertisements

Human Genetic Mutations
Human Genetic Mutations. 2 Main Types of Mutations 1.) Chromosomal Mutations 2.) Gene Mutations.
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.
Human Genetic Mutations
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
Human Genetic Mutations. 2 Main Types of Mutations 1.) Chromosomal Mutations 2.) Gene Mutations.
1.Most genetic disorders result from a mutation in one gene. a.Mutation: a change in an organism’s genetic material (DNA) 2.A mutated gene produces a.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
Human Genetic Mutations. 2 Main Types of Mutations 1.) Chromosomal Mutations 2.) Gene Mutations.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)
Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.
Mutations. What Are Mutations? MUTATION = A change in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur.
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
May occur in somatic cells (aren‘t passed to offspring)
Human Genetic Mutations
Section 1: Mutation and Genetic Change
Mutations and Nature vs. Nurture.
Mutations.
Mutations.
Mutations.
A mutation is a change in an organism’s DNA.
Mutations.
Mutations.
Mutations.
Copyright Pearson Prentice Hall
Mutations Add to Table of Contents – p. 14
Gene Mutations.
Mutations.
Mutations.
Human Genetic Mutations
Human Genetic Mutations
Mutations.
Mutations.
Mutation Lecture 11 By Ms. Shumaila Azam
Human Genetic Mutations
Types of point mutations
To be successful today…
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
A mutation is a change in an organism’s DNA.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
Some mutations affect a single gene, while others affect an entire chromosome.
Mutations Section 12-4.
Mutations.
Mutations.
Section 1: Mutation and Genetic Change
Mutations.
Human Genetic Mutations
A mutation is a change in an organism’s DNA.
Mutations.
Mutations.
Mutations.
Mutations.
Bellwork How do we account for the wide variety of organisms that are on the Earth?
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutations.
Mutations.
Mutations Good intro video
Draw a conclusion from this graph for both the red and blue line
Mutations.
Mutations.
Mutations.
Section 20.4 Mutations and Genetic Variation
Mutations.
Mutations.
Mutations.
Mutations.
Mutations.
Mutations: Changes in Genes
Presentation transcript:

Mutations Ms MacCormack Fall 2018

What is a mutation? Any change in the DNA base sequence. If it happens in gametes, it may affect an individual’s offspring/children. If it happens in somatic cells, it may affect the individual. May only involve a single base.

Are Mutations Helpful or Harmful? Mutations happen regularly. Almost all mutations are neutral. Chemicals and UV radiation cause mutations. Many mutations are repaired by enzymes.

Are Mutations Helpful or Harmful? Some types of skin cancers and leukemia result from somatic mutations. Some mutations may improves an organism’s survival.

Causes of Mutations Spontaneous Occur during DNA replication Caused by mutagens Physical – radiation from UV rays, X-rays or extreme heat Chemical – molecules that misplace base pairs or disrupt the helical shape of DNA

Types of Mutations Point Mutation Frameshift Mutation

Point Mutations One base (A, T, C or G) is substituted for another. 3 possible Consequences: Nonsense mutations – code for a stop, which can cause the premature end of translation. Missense mutations – code for a different amino acid Silent mutations – code for the same amino acid Example – Sickle Cell Anemia

Sickle Cell Anemia Occurs in the hemoglobin gene Causes the hemoglobin to be abnormally shaped which leads to the red blood cell being abnormally shaped. These red blood cells do not move easily through the blood vessels.

Frameshift Mutation Insert or delete one or more nucleotides Changes the “reading frame” Every amino acid AFTER this mutation is changed. Example – Cystic Fibrosis

Cystic Fibrosis The “CFTR” gene is mutated – 3 base pairs are deleted Mutant protein is missing an amino acid and cannot fold properly VS.

Key Ideas about Gene Mutations A mutated gene will make a mutated protein Mutant proteins are trouble!!! They do not go where they are supposed to go. They do not do what they are supposed to do. Mutation of a gene = Mutant Protein Dysfunctional proteins cause the symptoms of the disorder.