Let’s Review Who discovered the structure of DNA?

Slides:



Advertisements
Similar presentations
Nucleic Acids and Protein Synthesis
Advertisements

After today’s lesson you will be able to transcribe a DNA fragment into an RNA fragment and translate the RNA into a polypeptide.
Unit 4 Part I Transcription.
TRANSLATION/PROTEIN SYNTHESIS Unit 4 – Part 1. Central Dogma DNA mRNA Proteins Traits.
8.4 DNA Transcription 8.5 Translation
Transcription and Translation
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
Chapter 12 Making Proteins. Differences between RNA and DNA DNA = double strand; RNA = single strand RNA contains Ribose instead of deoxyribose. RNA uses.
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (GENE) codes for a particular protein;
RNA AND PROTEIN SYNTHESIS
DNA Transcription & Protein Translation. Today’s Objectives Introduce Protein Synthesis Compare types of nucleic acid.
Transcription and Translation How genes are expressed (a.k.a. How proteins are made) Biology.
A. Chromosomes are made of DNA B.Segments of DNA code for a protein C.A protein in turn, relates to a trait or a gene (examples: eye color, hair color,
I.Structure and Function of RNA A) Why is RNA needed? 1) proteins are made by ribosomes outside the nucleus (on the rough Endoplasmic Reticulum)
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
Section 20.2 Gene Expression
Genetics: RNA and Protein Synthesis
Biology 1-1c Protein Synthesis.
PROTEIN SYNTHESIS.
How does DNA instruct cells to make PROTEINS?
PROTEIN SYNTHESIS CHAPTER 10 section 4
RNA Another Nucleic Acid.
12.3 KEY CONCEPT Transcription converts DNA into a single-stranded RNA molecule. DNA can not leave nucleus..RNA CAN!
How to Make a Protein?.
DEOXYRIBONUCLEIC ACID
Protein Synthesis.
Protein Synthesis.
RNA Another Nucleic Acid.
BIOLOGY NOTES GENETICS PART 7 PAGES
DNA Transcription & Protein Translation
RNA Another Nucleic Acid.
Chapter 11: From DNA to Protein
Protein Synthesis.
Let’s Review Who discovered the structure of DNA?
Objective: Journal: Describe the process of protein synthesis
Notes – Protein Synthesis: Transcription
BIOLOGY NOTES GENETICS PART 7 PAGES
RNA Ribonucleic Acid.
Chp: 12 Transcription & Translation
Transcription & Translation.
From DNA to Proteins.
RNA carries DNA’s instructions.
RNA carries DNA’s instructions.
Protein Synthesis: Transcription
BIOLOGY NOTES GENETICS PART 7 PAGES
DNA Transcription & Protein Translation
Unit 5: Protein Synthesis.
Section 4 Protein Synthesis
Transcription and Translation
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
January 11, 2018 Objective: Journal:
13.1: RNA & Transcription.
Unit 7: Molecular Genetics
Protein Synthesis Part 1
Transcription/ Translation Notes 16-17
BIOLOGY NOTES GENETICS PART 7 PAGES
Transcription and RNA’s role
Steps of Translation.
RNA, Protein Synthesis, Transcription, and Translation
DNA Replication Living Environment 2015.
Protein Synthesis: An Overview
Protein Synthesis.
Transcription and the RNA code
Protein Synthesis.
Protein Synthesis.
12-3 RNA & Protein Synthesis
Protein Synthesis.
The Production of Proteins by DNA
Presentation transcript:

Let’s Review Who discovered the structure of DNA? They declared it as a “________ _______” When DNA copies itself, it is called ___________. Make the complementary strand: ATTCGCTACGAAT

Protein Synthesis

Central Dogma The central dogma of molecular biology states: DNA RNA Protein

I. How do chromosomes lead to specific traits? A. Chromosomes are made of DNA Segments of DNA code for a protein (genes) A protein in turn, relates to a trait (examples: eye color, hair color, enzymes, hormones…) Movie Review

Structure and Function of RNA Why is RNA needed? Proteins are made by ribosomes outside the nucleus and DNA cannot leave the nucleus (it’s stuck)  RNA is needed so that it can carry the genetic code needed for making proteins to the ribosomes

Structure and Function of RNA What is RNA? 1) RNA - Ribonucleic Acid a) the sugar in RNA is ribose  

Structure and Function of RNA b) RNA is single stranded c) Uracil replaces Thymine as a nitrogenous base in RNA

Structure and Function of RNA 2) There are 3 kinds of RNA a) r RNA - Ribosomal RNA - makes up ribosomes   b) mRNA- messenger RNA -carries the genetic code out of the nucleus to the ribosomes

Structure and Function of RNA c) tRNA- Transfer RNA - transfers amino acids to the ribosome in order to make proteins

Let’s Review Shoulder Partner Selector Face Partner What are genes? What organelle makes proteins? Why do we need RNA? What are three differences between RNA and DNA?

The RNA Code II. RNA Code a) mRNA carries the code for an amino acid in a series of 3 nucleotides (like DNA triplet)  b) A group of 3 mRNA nucleotides is called a codon.

The RNA Code   c) A group of 3 tRNA nucleotides is called an anti-codon (opposite of the codon) ex. mRNA codon = UAG tRNA anti-codon = AUC d) The genetic code is universal - codons code for the same amino acids in all known life forms

Protein Synthesis Protein Synthesis is a two part process 1) Transcription (in the nucleus) 2) Translation (in the cytoplasm)

Let’s Review Selector Where does transcription happen? Where does translation happen? What is a codon? Where is the anti codon?

Central Dogma DNA RNA Protein Transcription

Transcription III. Transcription - mRNA is copied from DNA Steps: 1) RNA polymerase binds to DNA at a promoter sequence & separates the strands 2) RNA nucleotides bond to the exposed bases on the DNA strand 3) Transcription continues until it reaches a termination sequence

Transcription

Transcription Let’s Practice: Write this at the bottom of the second page of your notes. Transcribe the DNA DNA – TATAGCCGATAGCTCCGTA mRNA - AUAUCGGCUAUCGAGGCAU

Central Dogma DNA RNA Protein Translation

Translation Translation - mRNA is used to make protein Steps: 1) mRNA leaves the DNA in the nucleus and travels to a ribosome 2) the ribosome begin “translating” the mRNA into protein when it reaches a “start” codon

Translation   3) the ribosome”translates” the mRNA into a sequence of amino acids that make up a specific protein 4) Translation continues until a “stop” codon is reached.

Translation

tRNA V. How do the Ribosome do their job? tRNA is the key 2) What is tRNA? tRNA carries an amino acid on one end. The other end contains the anti- codon (three nitrogen bases) that will match up with the mRNA codon.  

tRNA 3) tRNA molecules match their anti-codon to the mRNA codon 4)A protein is formed as tRNA’s release their amino acids which bond together to make a protein (peptide bond)

tRNA Protein (amino acid chain) Ribosome mRNA

Amino Acids All of the proteins in your body are made up of combinations of only 20 different amino acids linked together in different ways. Movie Review

How do we get proteins from genes (coding DNA)? Let’s find out: http://www.wisc-online.com/objects/index_tj.asp?objID=AP1302

Amino Acids Third Letter

AUGCUAAAGCGUGGUUCUUUGGCG Let's Practice Third Letter Write the mRNA sequence on to the bottom of the third page of the notes. Translate the mRNA into an amino acid sequence, using the chart above! AUGCUAAAGCGUGGUUCUUUGGCG

AUG/CUA/AAG/CGU/GGU/UCU/UUG/GCG Met – Leu – Lys – Arg – Gly – Ser – Leu - Ala

Review TRANSCRIPTION TRANSLATION (in the nucleus) 1. DNA helix opens 2. mRNA chain is copied from DNA TRANSLATION (in the cytoplasm) 1. mRNA attaches to a ribosome in the cytoplasm 2. tRNA molecules carrying amino acids match anti-codon to mRNA codon 3. Amino acids are released and bonded together to make a protein.