Asifa S. Haider, Judilyn Duculan, Julia A. Whynot, James G. Krueger

Slides:

Advertisements

Similar presentations

Molecular Markers of Early-Stage Mycosis Fungoides

Advertisements

Cell Surface CD74–MIF Interactions Drive Melanoma Survival in Response to Interferon-γ Keiji Tanese, Yuuri Hashimoto, Zuzana Berkova, Yuling Wang, Felipe.

Cell-specific activation profile of extracellular signal-regulated kinase 1/2, Jun N-terminal kinase, and p38 mitogen-activated protein kinases in asthmatic.

Serum Response Factor Controls Transcriptional Network Regulating Epidermal Function and Hair Follicle Morphogenesis Congxing Lin, Anna Hindes, Carole.

Increased Expression of CD44 and Hyaluronate Synthase 3 Is Associated with Accumulation of Hyaluronate in Spongiotic Epidermis Laurent Barnes, Pierre.

Gene Profiling of Narrowband UVB–Induced Skin Injury Defines Cellular and Molecular Innate Immune Responses Milène Kennedy Crispin, Judilyn Fuentes-Duculan,

HAX-1, Identified by Differential Display Reverse Transcription Polymerase Chain Reaction, Is Overexpressed in Lesional Psoriasis Alireza Mirmohammadsadegh,

Cell-specific activation profile of extracellular signal-regulated kinase 1/2, Jun N-terminal kinase, and p38 mitogen-activated protein kinases in asthmatic.

Decreased Expression of Caveolin-1 Contributes to the Pathogenesis of Psoriasiform Dermatitis in Mice Yukie Yamaguchi, Yuko Watanabe, Tomoya Watanabe,

Hyaluronan Metabolism in Human Keratinocytes and Atopic Dermatitis Skin Is Driven by a Balance of Hyaluronan Synthases 1 and 3 Jérémy Malaisse, Virginie.

Ahmad Waseem, Yasmin Alam, Anand Lalli

Rose-Anne Romano, Barbara Birkaya, Satrajit Sinha

Molecular Markers of Early-Stage Mycosis Fungoides

Fas Ligand Downregulation with Antisense Oligonucleotides in Cells and in Cultured Tissues of Normal Skin Epidermis and Basal Cell Carcinoma Jingmin.

Transcription Factor MafB Coordinates Epidermal Keratinocyte Differentiation Masashi Miyai, Michito Hamada, Takashi Moriguchi, Junichiro Hiruma, Akiyo.

Identification of a Potential Molecular Diagnostic Biomarker in Keloid Disease: Syndecan-1 (CD138) Is Overexpressed in Keloid Scar Tissue Rania A. Bagabir,

Stefan W. Stoll, Jessica L. Johnson, Yong Li, Laure Rittié, James T

Effects of Etanercept Are Distinct from Infliximab in Modulating Proinflammatory Genes in Activated Human Leukocytes Asifa S. Haider, Irma R. Cardinale,

Upregulation of Class II β-Tubulin Expression in Differentiating Keratinocytes Woong-Hee Lee, Joo-Young Kim, Young-Sik Kim, Hye-Joon Song, Ki-Joon Song,

Type II Collagen Accumulation in Overlying Dermo-Epidermal Junction of Pilomatricoma Is Mediated by Bone Morphogenetic Protein 2 and 4 Hideki Mieno,

Molecular Cloning and Expression of Human Keratinocyte Proline-Rich Protein (hKPRP), an Epidermal Marker Isolated from Calcium-Induced Differentiating.

Expression of Cholesterol Sulfotransferase (SULT2B1b) in Human Skin and Primary Cultures of Human Epidermal Keratinocytes Yuko Higashi, Hirotoshi Fuda,

Increased Expression of the Orphan Nuclear Receptor NURR1 in Psoriasis and Modulation following TNF-α Inhibition Marina O'Kane, Trevor Markham, Alice.

Cellular Genomic Maps Help Dissect Pathology in Human Skin Disease

Heparin-Binding Epidermal-Growth-Factor-Like Growth Factor Activation of Keratinocyte ErbB Receptors Mediates Epidermal Hyperplasia, a Prominent Side-Effect.

Malene B. Pedersen, Lone Skov, Torkil Menné, Jeanne D

Activation of Epidermal Growth Factor Receptor/ERK Signaling Correlates with Suppressed Differentiation in Malignant Acanthosis Nigricans Ingo Haase,

Stimulation of Purinergic Receptors Modulates Chemokine Expression in Human Keratinocytes Saveria Pastore, Francesca Mascia, Sara Gulinelli, Sylvia Forchap,

Gene Array Expression Profiling in Acne Lesions Reveals Marked Upregulation of Genes Involved in Inflammation and Matrix Remodeling Nishit R. Trivedi,

Yuangang Liu, James P. Lagowski, Shangpu Gao, James H

Cryptic Splicing at a Non-Consensus Splice-Donor in a Patient with a Novel Mutation in the Plakophilin-1 Gene Peter M. Steijlen, Maurice A.M. van Steensel,

Yifang Chen, Devendra S. Mistry, George L. Sen

Increased Expression of Carbonic Anhydrase II (CA II) in Lesional Skin of Atopic Dermatitis: Regulation by Th2 Cytokines Marijke Kamsteeg, Patrick L.J.M.

Oxygen-Dependent Differentiation of Human Keratinocytes

Effective Narrow-Band UVB Radiation Therapy Suppresses the IL-23/IL-17 Axis in Normalized Psoriasis Plaques Leanne M. Johnson-Huang, Mayte Suárez-Fariñas,

S100A15, an Antimicrobial Protein of the Skin: Regulation by E

Vitamin D Analog Calcipotriol Suppresses the Th17 Cytokine–Induced Proinflammatory S100 “Alarmins” Psoriasin (S100A7) and Koebnerisin (S100A15) in Psoriasis

MiR-125b, a MicroRNA Downregulated in Psoriasis, Modulates Keratinocyte Proliferation by Targeting FGFR2 Ning Xu, Petter Brodin, Tianling Wei, Florian.

The Spectrum of Mild to Severe Psoriasis Vulgaris Is Defined by a Common Activation of IL-17 Pathway Genes, but with Key Differences in Immune Regulatory.

Isolation and Characterization of a Putative Keratin-Associated Protein Gene Expressed in Embryonic Skin of Mice Mikiro Takaishi, Yoshimi Takata, Toshio.

Presence of Epstein–Barr Virus in Langerhans Cells of CTCL Lesions

Differential Expression of Phosphorylated NF-κB/RelA in Normal and Psoriatic Epidermis and Downregulation of NF-κB in Response to Treatment with Etanercept

Characterization of Kdap, A Protein Secreted by Keratinocytes

Keratinocyte-Specific Deletion of the Receptor RAGE Modulates the Kinetics of Skin Inflammation In Vivo Julia S. Leibold, Astrid Riehl, Jan Hettinger,

Prominent Production of IL-20 by CD68+/CD11c+ Myeloid-Derived Cells in Psoriasis: Gene Regulation and Cellular Effects Frank Wang, Edmund Lee, Michelle.

Noritaka Oyama, Keiji Iwatsuki, Yoshimi Homma, Fumio Kaneko

Expression of T-Cadherin in Basal Keratinocytes of Skin

Tumor-Associated Macrophages in the Cutaneous SCC Microenvironment Are Heterogeneously Activated Julia S. Pettersen, Judilyn Fuentes-Duculan, Mayte Suárez-Fariñas,

Evidence for Altered Wnt Signaling in Psoriatic Skin

Superantigens, Autoantigens, and Pathogenic T Cells in Psoriasis

Keratin 4 Upregulation by Retinoic Acid In Vivo: A Sensitive Marker for Retinoid Bioactivity in Human Epidermis1 Marie Virtanen, Hans Törmä, Anders Vahlquist

The Localization of Label-Retaining Cells in Mouse Nails

Mayte Suárez-Fariñas, Judilyn Fuentes-Duculan, Michelle A

Increased Expression of Wnt2 and SFRP4 in Tsk Mouse Skin: Role of Wnt Signaling in Altered Dermal Fibrillin Deposition and Systemic Sclerosis Julie Bayle,

Involvement of αvβ5 Integrin in the Establishment of Autocrine TGF-β Signaling in Dermal Fibroblasts Derived from Localized Scleroderma Yoshihide Asano,

Combined Use of Laser Capture Microdissection and cDNA Microarray Analysis Identifies Locally Expressed Disease-Related Genes in Focal Regions of Psoriasis.

Wynn H. Kao, Adam I. Riker, Deepa S. Kushwaha, Kimberly Ng, Steven A

Transcriptional Profiling of Psoriasis Using RNA-seq Reveals Previously Unidentified Differentially Expressed Genes Ali Jabbari, Mayte Suárez-Fariñas,

Toll-Like Receptor 3 Ligand Polyinosinic:Polycytidylic Acid Promotes Wound Healing in Human and Murine Skin Qing Lin, Li Wang, Youkun Lin, Xialin Liu,

Human Keratinocytes' Response to Injury Upregulates CCL20 and Other Genes Linking Innate and Adaptive Immunity Milène Kennedy-Crispin, Erika Billick,

Overexpression of the Oncofetal Fn Variant Containing the EDA Splice-in Segment in the Dermal–Epidermal Junction of Psoriatic Uninvolved Skin Kathleen.

IL-17A Upregulates Keratin 17 Expression in Keratinocytes through STAT1- and STAT3- Dependent Mechanisms Xiaowei Shi, Liang Jin, Erle Dang, Ting Chang,

A Single Intradermal Injection of IFN-γ Induces an Inflammatory State in Both Non- Lesional Psoriatic and Healthy Skin Leanne M. Johnson-Huang, Mayte.

Expression of FcRn, the MHC Class I-Related Receptor for IgG, in Human Keratinocytes Karla Cauza, Gabriele Hinterhuber, Ruth Dingelmaier-Hovorka, Karin.

Genomic Analysis Defines a Cancer-Specific Gene Expression Signature for Human Squamous Cell Carcinoma and Distinguishes Malignant Hyperproliferation.

Upregulation of Toll-Like Receptors (TLRs) 6, 7, and 8 in Keloid Scars

Insights into Gene Modulation by Therapeutic TNF and IFNγ Antibodies: TNF Regulates IFNγ Production by T Cells and TNF-Regulated Genes Linked to Psoriasis.

Redistribution of LRIG Proteins in Psoriasis

Fas Ligand Downregulation with Antisense Oligonucleotides in Cells and in Cultured Tissues of Normal Skin Epidermis and Basal Cell Carcinoma Jingmin.

Heparin-Binding EGF-Like Growth Factor Is Induced by Disruption of Lipid Rafts and Oxidative Stress in Keratinocytes and Participates in the Epidermal.

Presentation transcript:

Increased JunB mRNA and Protein Expression in Psoriasis Vulgaris Lesions Asifa S. Haider, Judilyn Duculan, Julia A. Whynot, James G. Krueger Journal of Investigative Dermatology Volume 126, Issue 4, Pages 912-914 (April 2006) DOI: 10.1038/sj.jid.5700183 Copyright © 2006 The Society for Investigative Dermatology, Inc Terms and Conditions

Figure 1 Gene expression analysis of JunB in psoriasis. (a) Representative gene array analysis of mRNA from psoriasis lesions (LS) and non-lesional (NL) 6mm punch skin biopsies. mRNA was isolated from and hybridized to individual oligonucleotide arrays containing ∼12,000 human genes (HG-U95A arrays), as described in our recent study (Haider et al., 2005). The figure represents the heat map of representative unsupervised hierarchical clustering for gene expressions of signal transducer and activator of transcription 1 (STAT1), JunB, c-Jun, chemokine ligand 27 (CCL27), keratin 16 (KRT16), small proline-rich protein 1A/B (SPRR1A, SPRR1B), involucrin (IVL), gap junction protein (GJA1), and early growth response 1 (EGR1) with fold change differences in gene expressions in LS versus NL and the P-values (after Benjamini and Hoechberg correction for multiplicity). Red: upregulated; green: downregulated relative gene expression. (b) mRNAs in LS and NL from 26 patients were analyzed by real time reverse transcription-PCR measurements as described in our recent study (Haider et al., 2005). Primer sequences were as follows: K16-forward GCGAGGATGCCCACCTTT, K16-reverse GAAGACCTCGCGGGAAGAAT, K16 probe 6FAM-CCCAGCAAGCATCTGGCCAATCC-TAMRA (GenBank accession number AF061809). The primers and probes for JunB (assay ID Hs00357891) were designed by Applied Biosystems (Foster City, CA, USA). All primers and probes were purchased from Applied Biosystems. Mean values of gene expression for selected genes are shown after normalization of expressions using human acidic ribosomal protein (HARP) mRNA. mRNA was analyzed from LS and NL skin biopsies (n=26 for each): error bars are shown; **P<0.001. Journal of Investigative Dermatology 2006 126, 912-914DOI: (10.1038/sj.jid.5700183) Copyright © 2006 The Society for Investigative Dermatology, Inc Terms and Conditions

Figure 2 Immunohistochemical and immunofluorescence analysis of JunB in lesional and non-lesional tissue. Immunohistochemical and immunofluorescence analysis of JunB in psoriasis lesional (LS) and non-lesional (NL) tissue sections of 12 patients with psoriasis, stained as described previously (Gottlieb et al., 2005) with mouse anti-human monoclonal antibodies to JunB (clone C-11: Santa Cruz Biotechnology, Santa Cruz, CA, USA). (a) For immunohistochemistry, a biotin-labeled horse anti-mouse secondary antibody (PK6102; Vector Lab, Burlingame, CA, USA) was localized with avidin–biotin complex and developed with chromogen 3-amino-9-ethylcarbazole (A-5754; Sigma Aldrich, St Louis, MO, USA). (b) For immunofluorescence, LS and NL tissue sections were stained with mouse anti-human monoclonal antibody to JunB and detected with an Alexa Fluor 568-conjugated goat antibody to mouse IgG (A21124; Molecular Probes, Eugene, OR, USA). No staining of the epidermis was seen with a control mouse IgG isotype antibody (not shown). Bar=100μm. Journal of Investigative Dermatology 2006 126, 912-914DOI: (10.1038/sj.jid.5700183) Copyright © 2006 The Society for Investigative Dermatology, Inc Terms and Conditions