Unlocking the mystery of DNA Liz LaRosa www.middleschoolscience.com 2011

Prior to the 1950’s What we knew: Inherited characteristics are determined by genes Genes are passes from one generation to the next Genes are part of a chromosome Chromosomes are made of protein and DNA

Cell division and DNA replication Cells divide Growth, Repair, Replacement Before cells divide, they have to double cell structures, organelles and their genetic information

DNA replication – Mitosis & Meiosis

But… What did DNA look like, and how did it replicate itself?

Discovering the structure of DNA Rosalind Franklin (1920-1958) King’s College, London Made significant advances in x- ray diffraction techniques with DNA Her images suggested that DNA had a spiral shape One of her DNA images

Discovering the structure of DNA Maurice Wilkins – (1916-2004) King’s College, London Also did X-ray diffraction studies of DNA Worked with Rosalind Franklin Shared information with Watson and Crick

Discovering the structure of DNA Erwin Chargaff – (1905-2002) Columbia University, NY Investigated the composition of DNA His findings by 1950 strongly suggested the base-pairings of A-T & G-C Met with Watson and Crick in 1952 and shared his findings “Chargaff’s rule” A = T & C = G

Discovering the structure of DNA James Watson (1928) and Francis Crick (1916-2004) Worked together at Cavendish Laboratory in Cambridge to determine the structure of DNA Used work from Franklin, Wilkins, and Chargaff to determine the double helix shape Watson, Crick, and Wilkins were awarded the Nobel Prize Rosalind Franklin passed away (1958) before the Nobel Prize was awarded in 1962

Discovering the structure of DNA DNA = Deoxyribose nucleic acid Present in all living cells Contains all the information Nucleotides: a subunit that consists of: a sugar (deoxyribose) a phosphate and one nitrogen base – 4 different bases Adenine (A) and Thymine (T) Guanine (G) and Cytosine (C)

DNA – What does my code look like? Computer Code: 10010100111010001100101001110010111100101001001001001011100101000101010010010100101010010010100101001010100101001010010101010101001010100101010111111100 DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases… “Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law

G A T T A C A C T A A T G T Practice DNA Base Pairs “Gattaca” is a science fiction movie starring Uma Thurman, Ethan Hawke, and Jude Law

DNA replication – helix unzips

DNA replication – helix unzips

DNA replication – two strands are separated

DNA replication – each side is now a template

DNA replication – two identical strands of DNA Original DNA strands

DNA replication Newly assembled DNA strands

DNA replication Semi-conservative replication

Build a DNA molecule – you try it! http://learn.genetics.utah.edu/content/begin/dna/builddna/

DNA replication- you try it! http://www.pbs.org/wgbh/aso/tryit/dna/shockwave.html