What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC What does it matter???

CACGTGGACTGAGGACTCCTC Codon for CTC = glutamate CACGTGGACTGAGGACACCTC Codon for CAC = valine What does it matter???

Mutations

Any mistake or change in DNA sequence Mutations Any mistake or change in DNA sequence What causes them? Random or Environment influences – X-rays, UV rays, radioactive materials, chemicals, medications

Mutagens  Radiation – UV, X-rays, nuclear

Mutagens  Chemicals – asbestos, formaldehyde, chemicals in tobacco products (many mutagens are also carcinogens – cancer causing)

be good, making an organism survive better in its environment Example: bacteria becoming antibiotic-resistant The ability to drink milk as an adult is a helpful mutation.

usually happens during DNA replication in sex cells, it may affect individual’s offspring/children in body cells, it may affect the individual

More about mutations Can be beneficial, harmless, or harmful 2 types: Gene & Chromosomal

Gene mutation: Changes to the bases in the DNA of ONE gene Chromosomal mutation: affects whole or part of a chromosome

1. Gene Mutations Change in one or more nucleotides Affects the amino acids and protein produced 2 types

 Point Mutation - a substitution of a single base pair - changes only one amino acid (if any!) Ex: The dog bit the CAT The dog bit the CAR

Sickle Cell Anemia

Some Point Mutations are Harmless What amino acid is represented by the DNA sequence GGA? What amino acid is represented by the DNA sequence GGC? This change in the 3rd base of the codon is a point mutation, yet the amino acid would remain the same. Therefore, the protein would NOT be affected.

Some Point Mutations are Harmless This type of point mutation is called a silent mutation. Silent Mutations are possible due to the redundancy in the genetic code.

 Frameshift Mutation Single base pair is added or deleted from DNA Causes a shift in the “reading frame” Ex: Cystic Fibrosis EX: cystic fibrosis

Nonsense Mutations A point mutation or a shift in the reading frame can sometimes cause a premature STOP codon This type of mutation is called a nonsense mutation If the nonsense mutation occurs early in the mRNA sequence, the protein is greatly shortened and most likely non functional

Some mutations are beneficial Gain-of-function mutations produce a functional protein that results in an entirely new trait These mutations are usually beneficial and result in an advantage in an organism’s environment EX: The mutation that resulted in eyesight

Practice – Name that Mutation 1 2 Deletion ~ Frameshift Silent ~ Point 4 3 Insertion, nonsense ~ Frameshift Point 6 5 Deletion ~ Frameshift Nonsense ~ Point

Types of Mutations 2. Chromosomal mutation – may affect more than one gene Examples: nondisjunction, deletion, insertion, inversion, translocation

What’s Happening in Japan