Simulation of Hybridization

Slides:



Advertisements
Similar presentations
RNA structure prediction. RNA functions RNA functions as –mRNA –rRNA –tRNA –Nuclear export –Spliceosome –Regulatory molecules (RNAi) –Enzymes –Virus –Retrotransposons.
Advertisements

1. Find the cost of each of the following using the Nearest Neighbor Algorithm. a)Start at Vertex M.
AI Practice 05 / 07 Sang-Woo Lee. 1.Usage of SVM and Decision Tree in Weka 2.Amplification about Final Project Spec 3.SVM – State of the Art in Classification.
Blueprint for NACST/Sim 신수용. © 2002, SNU BioIntelligence Lab, Main concept Implementing Hybridization first. Then, ligation,
Artificial Intelligence Chapter 14. Resolution in the Propositional Calculus Artificial Intelligence Chapter 14. Resolution in the Propositional Calculus.
Predicting RNA Structure and Function. Non coding DNA (98.5% human genome) Intergenic Repetitive elements Promoters Introns mRNA untranslated region (UTR)
Artificial Intelligence Chapter 14 Resolution in the Propositional Calculus Artificial Intelligence Chapter 14 Resolution in the Propositional Calculus.
CISC667, F05, Lec27, Liao1 CISC 667 Intro to Bioinformatics (Fall 2005) Review Session.
Predicting RNA Structure and Function. Nobel prize 1989 Nobel prize 2009 Ribozyme Ribosome.
서울대학교 컴퓨터공학부 바이오지능 연구실 2014 Spring Semester Course Instructor: Prof. Byoung-Tak Zhang TAs: Ha-Young Jang & Beom-Jin Lee Classroom: , Time:
Chapter 13 Genetic Algorithms. 2 Data Mining Techniques So Far… Chapter 5 – Statistics Chapter 6 – Decision Trees Chapter 7 – Neural Networks Chapter.
Is DNA Computing Viable for 3-SAT Problems? Dafa Li Theoretical Computer Science, vol. 290, no. 3, pp , January Cho, Dong-Yeon.
RNA Secondary Structure Prediction. 16s rRNA RNA Secondary Structure Hairpin loop Junction (Multiloop)Bulge Single- Stranded Interior Loop Stem Image–
A Realization of Information Gate by Using Enterococcus faecalis Pheromone System Kenichi Wakabayashi and Masayuki Yamamura Preliminary Proceedings of.
Biomolecular Computation in Virtual Test Tubes 7 th International Meeting on DNA Based Computers, p75-83, June 10-13, 2001 Max Garzon, Chris Oehmen Summarized.
Data Mining In contrast to the traditional (reactive) DSS tools, the data mining premise is proactive. Data mining tools automatically search the data.
DNA structure simulation based on sequence-structure relationship HaYoung Jang
What is DNA Computing? Shin, Soo-Yong Artificial Intelligence Lab.
Stochastic Computing with Biomolecular Automata R. Adar, Y. Benenson, G. Linshiz, A. Rosner, N. Tishby, and E. Shapiro PNAS, vol. 101, no. 27, pp ,
(C) 2002, SNU Biointelligence Lab, A Computer Scientist’s Guide to Molecular Biology Biointelligence Lab. Interdisciplinary Program.
A Chinese Postman Problem Based on DNA Computing Z. Yin, F. Zhang, and J. Xu* J. Chem. Inf. Comput. Sci. 2002, 42, Summarized by Shin, Soo-Yong.
Computational and experimental analysis of DNA shuffling : Supporting text N. Maheshri and D. V. Schaffer PNAS, vol. 100, no. 6, Summarized by.
The Inference via DNA Computing Piort Wasiewicz et al. Proceedings of the 1999 Congress on Evolutionary Computation, vol. 2, pp Cho, Dong-Yeon.
(C) 2002, SNU Biointelligence Lab, Strategies for the development of a peptide computer Hubert Hug and Rainer Schuler Bioinformatics,
(C) 2002, SNU Biointelligence Lab, Immunocomputing for Bioarrays Alexander O. Tarakanov, et al. Proceedings of ICARIS 2002,
Chapter 4. Analysis of Brain-Like Structures and Dynamics (2/2) Creating Brain-Like Intelligence, Sendhoff et al. Course: Robots Learning from Humans 09/25.
Poster Design & Printing by Genigraphics ® Esposito, D., Heitsch, C. E., Poznanovik, S. and Swenson, M. S. Georgia Institute of Technology.
DNASequenceGenerator: A Program for the construction of DNA sequences Udo Feldkamp, Sam Saghafi, Wolfgang Banzhaf, Hilmar Rauhe DNA7 pp Summarized.
Artificial Intelligence Chapter 7 Agents That Plan Biointelligence Lab School of Computer Sci. & Eng. Seoul National University.
Biointelligence Lab School of Computer Sci. & Eng. Seoul National University Artificial Intelligence Chapter 8 Uninformed Search.
Molecular Evolutionary Computing (MEC) for Maximum Clique Problems March 9, 2004 Biointelligence Laboratory School of Computer Science and Engineering.
CISC667, S07, Lec25, Liao1 CISC 467/667 Intro to Bioinformatics (Spring 2007) Review Session.
Data Mining is the process of analyzing data and summarizing it into useful information Data Mining is usually used for extremely large sets of data It.
Chapter 9. The PlayMate System （ 2/2 ） in Cognitive Systems Monographs. Rüdiger Dillmann et al. Course: Robots Learning from Humans Summarized by Nan Changjun.
POA Simulation MEC Seminar 임희웅.
Stochastic Context-Free Grammars for Modeling RNA
Wet (DNA) computing 2001년 9월 20일 이지연
A Surface-Based DNA Algorithm for the Expansion of Symbolic Determinants Z. Frank Qiu and Mi Lu Third Workshop on Bio-Inspired Solutions to Parallel Processing.
Chapter 13.2 Manipulating DNA.
DNA Implementation of Theorem Proving
High-throughput Biological Data The data deluge
PNA-mediated Whiplash PCR
DNA Computing and Molecular Programming
Stochastic Context-Free Grammars for Modeling RNA
Fuzzy logic with biomolecules
Computational and experimental analysis of DNA shuffling
Summarized by In-Hee Lee
Biointelligence Lab School of Computer Sci. & Eng.
Subhayu Basu et al. , DNA8, (2002) MEC Seminar Su Dong Kim
Horn Clause Computation by Self-Assembly of DNA Molecules
JSPS Project on Molecular Computing (presentation by Masami Hagiya)
Improved Real-Time Multiplex Polymerase Chain Reaction Detection of Methylenetetrahydrofolate Reductase (MTHFR) 677C>T and 1298A>C Polymorphisms Using.
Fitness measures for DNA Computing
Maximal Clique Problem with Experiment
Biointelligence Lab School of Computer Sci. & Eng.
Artificial Intelligence Chapter 8 Uninformed Search
Pegna, J.M., Lozano, J.A., and Larragnaga, P.
(c) SNU CSE Biointelligence Lab,
Adaptive Cooperative Systems Chapter 6 Markov Random Fields
S. Kikuchi, D. Tominaga, M. Arita, K. Takahashi, and M. Tomita
Artificial Intelligence Chapter 7 Agents That Plan
Adaptive Cooperative Systems Chapter 3 Coperative Lattice Systems
Molecular Genetic Programming
Russell Deaton, junghuei Chen, hong Bi, and John A. Rose
Parallel BFS for Maximum Clique Problems
Using Bayesian Network in the Construction of a Bi-level Multi-classifier. A Case Study Using Intensive Care Unit Patients Data B. Sierra, N. Serrano,
Nearest-neighbor model for Tm
Designs for Autonomous Unidirectional Walking DNA Devices
Universal Biochip Readout of Directed Hamiltonian Path Problems
Three Dimensional DNA Structures in Computing
Presentation transcript:

Simulation of Hybridization Jang HaYoung

NACST/Sim Lab experiment simulation tool Hybridization, PCR, gel electrophoresis Using thermodynamic data & artificial chemistry Hybridization simulator © 2003 SNU CSE Biointelligence Lab

© 2003 SNU CSE Biointelligence Lab NACST/Sim Virtual Hybridization Essential to almost all the lab experiment. First step to simulation of lab experiment. © 2003 SNU CSE Biointelligence Lab

© 2003 SNU CSE Biointelligence Lab NACST/Sim Nearest Neighbor method with 1-base mismatch © 2003 SNU CSE Biointelligence Lab

© 2003 SNU CSE Biointelligence Lab NACST/Sim Nearest Neighbor method CGTACCTTAGGCT AGCTTAGGATGGCATGGAATCCGATGCATGGC © 2003 SNU CSE Biointelligence Lab

© 2003 SNU CSE Biointelligence Lab NACST/Sim Difficulties © 2003 SNU CSE Biointelligence Lab

© 2003 SNU CSE Biointelligence Lab NACST/Sim Difficulties Nearest Neighbor method? How can handle chain reaction? What is the reasonable size of the tube? How can detect the result? © 2003 SNU CSE Biointelligence Lab

© 2003 SNU CSE Biointelligence Lab NACST/Sim Objective Parallelize? Refine the data structure Use sigmoid function as decision maker Handle the bulge and hairpin © 2003 SNU CSE Biointelligence Lab

DNA/RNA Secondary Structure Thermodynamic method: Free Energy minimization– Zuker algorithm. Phylogenetic comparative method Grammar induction method Molecular Dynamics © 2003 SNU CSE Biointelligence Lab

DNA/RNA Secondary Structure Grammar induction method Use stochastic context-free grammar Parse tree of the sequences represents the secondary sturcture A kind of thermodynamic method How can design the grammar? © 2003 SNU CSE Biointelligence Lab

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.