Volume 19, Issue 7, Pages (July 2011)

Slides:



Advertisements
Similar presentations
Volume 17, Issue 6, Pages (June 2009)
Advertisements

Genetic Engineering and Manufacturing of Hematopoietic Stem Cells
Volume 19, Issue 1, Pages (January 2011)
From: Gene Therapy with Brain-Derived Neurotrophic Factor As a Protection: Retinal Ganglion Cells in a Rat Glaucoma Model Invest. Ophthalmol. Vis. Sci..
Volume 15, Issue 6, Pages (June 2007)
Volume 20, Issue 2, (February 2012)
Volume 24, Issue 7, Pages (July 2016)
Man's Best Friend: Utilizing Naturally Occurring Tumors in Dogs to Improve Chimeric Antigen Receptor T-cell Therapy for Human Cancers  Melinda Mata, Stephen.
Genome-editing Technologies for Gene and Cell Therapy
Volume 17, Issue 11, Pages (November 2009)
Volume 22, Issue 4, Pages (April 2014)
Volume 25, Issue 3, Pages (March 2017)
162. Stability of Polymer/Plasmid DNA Complexes In Vitro and In Vivo
281. Rapid Generation of Induced Pluripotent Stem Cells (iPSCs) from the Urine of a Patient with Duchenne Muscular Dystrophy    Molecular Therapy  Volume.
Volume 12, Issue 4, Pages (October 2005)
Direct Conversion of Skin Cells into Blood: Alchemy or Science?
Recent Developments in Retroviral-Mediated Gene Transduction
Volume 14, Issue 4, Pages (October 2006)
Volume 11, Issue 6, Pages (June 2005)
Evolving Gene Therapy in Primary Immunodeficiency
Volume 23, Issue 5, Pages (May 2015)
Escaping the Valley of Death
Volume 10, Issue 1, Pages (July 2004)
Volume 15, Issue 5, Pages (May 2007)
Volume 22, Issue 3, Pages (March 2014)
Volume 19, Issue 4, Pages (April 2011)
Volume 12, Issue 3, Pages (September 2005)
A atgaagacagtgactggacctttgttcctgtgcttctggctgcagctgaactgtgtgagcagaggcgagcaggtggagcagcgccctcctcacctgagtgtccgggagggagacagtgccgttatcatctgcacctacacagaccctaacagttattacttcttctggtacaagcaagagccgggggcaggtcttcagttgcttatgaaggttttctcaagtacggaaataaacgaaggacaaggattcactg
Molecular Therapy - Methods & Clinical Development
Volume 9, Issue 4, Pages (April 2004)
Volume 25, Issue 8, Pages (August 2017)
Molecular Therapy - Methods & Clinical Development
Lentiviral vectors containing mouse Csf1r control elements direct macrophage-restricted expression in multiple species of birds and mammals  Clare Pridans,
Genome-editing Technologies for Gene and Cell Therapy
Volume 16, Issue 12, Pages (December 2008)
Volume 24, Issue 11, Pages (November 2016)
Molecular Therapy  Volume 20, (May 2012) DOI: /S (16)
Molecular Therapy  Volume 7, Issue 5, (May 2003) DOI: /S (16)
Volume 15, Issue 5, Pages (May 2007)
847. Eradication of Therapy-Resistant Human Prostate Tumors Using an Ultrasound Guided Site-Specific Cancer Terminator Virus Delivery Approach    Molecular.
Designer Lipids Advance Systemic siRNA Delivery
Effective Gene Therapy of Mice with Congenital Erythropoietic Porphyria Is Facilitated by a Survival Advantage of Corrected Erythroid Cells  Elodie Robert-Richard,
660. Bowel/Bladder Sensation and Control in Patients with Spinal Cord Injury Treated with Human Embryonic Stem Cell Therapy  Geeta Shroff  Molecular Therapy 
521. Multiplex Genome Editing of TCR°/CD52 Genes as a Platform for “Off the Shelf” Adoptive T-Cell Immunotherapies    Molecular Therapy  Volume 22, Pages.
Volume 15, Issue 8, Pages (August 2007)
Volume 15, Issue 11, Pages (November 2007)
Molecular Therapy  Volume 18, Pages S260-S261 (May 2010) DOI: /S (16)
Volume 15, Issue 4, Pages (April 2007)
In This Issue Molecular Therapy Volume 16, Issue 4, (April 2008)
Volume 11, Issue 6, Pages (June 2005)
521. AAV Immunotherapy Induces Functional Antigen Specific Regulatory T-Cells to a Neuroantigen: A Potential Treatment for MS  Brad E. Hoffman  Molecular.
Volume 17, Issue 6, Pages (June 2009)
740. Prevention of Radiation-Induced Lung Injury by Administration of Gene-Modified Mesenchymal Stem Cells    Molecular Therapy  Volume 20, Pages S285-S286.
Molecular Therapy  Volume 21, Pages S247-S248 (May 2013)
Shigeki Yagyu, Malcolm K. Brenner
Volume 15, Issue 9, Pages (September 2007)
Volume 21, Issue 1, Pages (January 2013)
86. A Highly Compact Epitope-Based Marker Suicide Gene for Safer and Easier Adoptive T-Cell Gene Therapy    Molecular Therapy  Volume 20, Pages S35-S36.
Molecular Therapy - Methods & Clinical Development
Volume 23, Issue 4, Pages (April 2015)
Volume 9, Issue 2, Pages (February 2004)
Volume 19, Issue 1, Pages (January 2011)
441. Direct Comparison of EF1α and PGK Promoters Reveals Superior Performance of the PGK Promoter for Expression of the Common Gamma Chain in a Canine.
Morton J Cowan, Hans-Peter Kiem  Molecular Therapy 
Molecular Therapy - Nucleic Acids
Volume 7, Issue 3, Pages (March 2003)
Volume 21, Issue 3, Pages (March 2013)
Volume 11, Issue 5, Pages (May 2005)
Recent Developments in Retroviral-Mediated Gene Transduction
A Double-Switch Vector System Positively Regulates Transgene Expression by Endogenous microRNA Expression (miR-ON Vector)  Mario Amendola, Alice Giustacchini,
Presentation transcript:

Volume 19, Issue 7, Pages 1193-1198 (July 2011) Stem Cell Gene Therapy for Fanconi Anemia: Report from the 1st International Fanconi Anemia Gene Therapy Working Group Meeting  Jakub Tolar, Jennifer E Adair, Michael Antoniou, Cynthia C Bartholomae, Pamela S Becker, Bruce R Blazar, Juan Bueren, Thomas Carroll, Marina Cavazzana-Calvo, D Wade Clapp, Robert Dalgleish, Anne Galy, H Bobby Gaspar, Helmut Hanenberg, Christof Von Kalle, Hans-Peter Kiem, Dirk Lindeman, Luigi Naldini, Susana Navarro, Raffaele Renella, Paula Rio, Julián Sevilla, Manfred Schmidt, Els Verhoeyen, John E Wagner, David A Williams, Adrian J Thrasher  Molecular Therapy  Volume 19, Issue 7, Pages 1193-1198 (July 2011) DOI: 10.1038/mt.2011.78 Copyright © 2011 The American Society of Gene & Cell Therapy Terms and Conditions

Figure 1 The lentiviral vector pC/RRL-PGK-FANCA-WPRE. CMV, cytomegalovirus; cPPT, central polypurine tract; FANCA, Fanconi anemia cDNA; PGK, phosphoglycerate kinase; RRE, rev responsive element; SA, splice acceptor; SD, splice donor; WPRE, safety-optimized version of the woodchuck hepatitis virus posttranscriptional regulatory element. Molecular Therapy 2011 19, 1193-1198DOI: (10.1038/mt.2011.78) Copyright © 2011 The American Society of Gene & Cell Therapy Terms and Conditions