Reading Frames and ORF’s

Reading Frames A piece of DNA has 6 possible reading frames It is read in blocks of 3 nucleotides – a codon 1 2 3 -1 -2 -3 Symbols used in figure *** stop-codon >>> start-codon in frames 1,2 or 3 <<< start-codon in frames -1,-2 or -3 ))) Alternative start-codon (not important here) ((( Alternative start codon (not important here) http://www.cbs.dtu.dk/services/VirtualRibosome/

Bla A codon. 3 nucleotides Represent a fraction of a codon. 1 or 2 nucleotides Represents an intron 123 123 123 1 23 123 stop-codon DNA sequence c ATG TTC CGA T gtccctagcgtag AC TCA TAA  Exon 1   Intron  Exon2 Sequence counter 1 234 567 8910 11 …. mRNA sequence

Reading frame and reverse complement Having a piece of DNA like: 5-TGCCATGCATAGCCCCTGCCATA-3 Forward strings & reading frames 1 : 5-TGCCATGCATAGCCCCTGCCATA-3 2 : 5-GCCATGCATAGCCCCTGCCATA-3 3 : 5-CCATGCATAGCCCCTGCCATA-3 Reverse and complement strings -1: ATACCGTCCCCGATACGTACCGT -> 5-TATGGCAGGGGCTATGCATGGCA-3 -2: ATACCGTCCCCGATACGTACCG -> 5-TATGGCAGGGGCTATGCATGGC-3 -3: ATACCGTCCCCGATACGTACC -> 5-TATGGCAGGGGCTATGCATGG-3 Another example of reading frames 1,2,3 on the plus strand 1 2 3

ORF ORF – Open Reading Frame A continuous stretch of codons that do not contain a stop codon There are many ORF in the human genome – NOT all of them are transcribed Within an ORF you can look for a START codon and use prediction tools to guess/predict if a gene or at least an exon is located within that region Removal of intron regions in eukaryotes is a complex process (spliceosome) Prokaryotes do NOT have the small ribonucleoproteins involved in the spliceosome so no intron regions in ex Bacteria, but as always exceptions do occur (self-splicing introns).