Genetic Engineering

Warm-Up Questions What does the phrase “genetic engineering” mean to you? How has your life, or society as a whole, been impacted by genetic engineering?

“The Genetics is Right” Which product does not contain GM ingredients?

Current GM Food Products Soybeans Corn Cotton canola Rice Bananas Fish Fruit trees

History of Food Technology 8000 B.C. end of nomadic era, agriculture begins 1800 B.C. people use microorganisms (yeast) to create food A.D. 1795 metal and glass packaging invented 1856 Pasteurization invented 1865 Genes and traits identified 1914 Quick frozen foods invented 1922 Hybrid corn achieved by cross-breeding 1953 DNA discovered 1973 Genes transferred from one organism to another 1990 US gov’t approves 1st biotechnology product Mid 1990s commercialization of biotechnology products

Genetic Engineering What is the genetic material? DNA The code that defines life

DNA – The Code Sequence of bases G T C A

DNA and Genes GCTACCGGTCAGGTCAAAACTGGTTGCGCTACATCACGTGTGACACGTCA

DNA and Genes size Growth rate Pest resistance Vitamin content taste GCTACCGGTCAGGTCAAAACTGGTTGCGCTACATCACGTGTGACACGTCA size Growth rate Pest resistance Vitamin content taste

DNA and Genes Unknown genes size Growth rate Pest resistance GCTACCGGTCAGGTCAAAACTGGTTGCGCTACATCACGTGTGACACGTCA size Growth rate Pest resistance Vitamin content taste

DNA and Genes Genetic Engineering Unknown genes GCTACCGGTCAGGTCAAAACTGGTTGCGCTACATCACGTGTGACACGTCA size Growth rate Pest resistance Vitamin content taste We can target these genes and change them Genetic Engineering

Genetic Engineering Definition Changing the genetic makeup of cells by introducing or eliminating specific genes using molecular biology techniques. Also known as biotechnology

Why would we do it? Can change properties in a positive way Grow higher Grow faster Pest resistant More nutritious Sweeter taste

So What’s the Catch? Positive changes can have negative effects too Some may be tolerable Some may be devastating

Gene Corn Project Goal Genetic Engineering Design Company Design a genetically engineered corn product Develop marketing campaign Genetic Engineering Design Company Groups of 2 students

DNA and Genes Your company can select 2 genes to modify Unknown genes Grow-hi Grow-fast Pest-free Super vitamin Ultra-sweet Your company can select 2 genes to modify Develop marketing campaign

Project Schedule Schedule Topic Activities Time allotted Monday Gene Design Activity Select genes, complete design worksheet 15 min Rough draft of marketing campaign 30 min Tuesday Gene Design Activity cont’d Final draft of marketing campaign 45 min Wednesday Presentations Presentations of marketing campaign. 55 min (2 min per group) Evaluation of other students’ presentations Thursday Assessment Post test Student feedback 10 min

Project Directions and Grading Criteria Project Requirements Project Directions and Grading Criteria Points Earned Possible Project Component Criteria Instructions 5 Completion of Design Worksheet Day 1, 15 minute deadline Shared responsibility. See attached document Rough draft of marketing campaign Day 1, 30 minute deadline See below. Final draft of marketing campaign Day 2, 45 minute deadline. Power point, flyer, or poster. Prepared prompt cards. 35 Presentation of marketing campaign Day 3, 2-minute presentation. 15 Assessment of presentations Day 3, Assess each presentation, based on assigned persona. Individual responsibility. See attached document. Post test Day 4, Respond to written test questions.

Marketing Campaign The following is required PowerPoint presentation, or a poster display large enough to be read by the class, or a flyer to distribute to the class. Product name that reflects the modifications. Must describe the genes you modified and why you modified them. Must identify the advantages of your modifications. Must describe why people should buy your product. Must give a 2-minute presentation, each group member speaking for 1 minute.

Engineering Design Process Identify product need Research available options Identify pros and cons of design options Choose best design Communicate design choice to broader audience Critically evaluate other engineering designs to identify the appropriate solution Gene info worksheet Design worksheet Marketing campaign

Resources Guide to Biotechnology http://www.bio.org/speeches/pubs/er/ Current biotech food products http://www.bio.org/speeches/pubs/er/agri_products.asp http://www.ornl.gov/sci/techresources/Human_Genome/elsi/gmfood.shtml