HeLa COS-7 Supplementary Figure S1 Coelho et al (2014) MM pSPL3 MM

Slides:

Advertisements

Similar presentations

P247. Figure 9-1 p248 Figure 9-2 p251 p251 Figure 9-3 p253.

Advertisements

(z=7) (z=7) (z=7) (z=7) MSMS/MS Ba 7702 Bc AH819 Bc Bc AH259 b y y b b 9 2+ b y 33.

( ) 2.2 FC autism control FGR1OP2. ( ) 1.4 FC autism control SMAD2.

Nardella et al. Supplementary Fig. 1 Murine Rheb wt Line 47 Line 50 Log gene expression (a.u.) ******* 200 bp Founders

Supplementary data/figures Khanim et al. Supplementary Figure 1 Figure 1A: Schematic of the two-step fluorescent NADPH assay used for identifying compounds.

Farmer et al Supplementary Figure 1 KU PARP-1 IC 50 = 3.2nM KU PARP-1 IC 50 = 3.4nM KU PARP-1 IC 50 = 730nM a b

Supplementary Tables and Figures Li Y et al, p27 is a candidate prognostic biomarker and metastatic promoter in osteosarcoma.

The reading is 7.38 mm. The reading is 7.72 mm.

ΜΕΤΑΣΥΛΛΕΚΤΙΚΗ ΦΥΣΙΟΛΟΓΙΑ ΕΡΓΑΣΤΗΡΙΟ 3. Μετασυλλεκτική Εργ3-Λιοσάτου Γ.2 ΒΙΟΛΟΓΙΚΟΙ ΠΑΡΑΓΟΝΤΕΣ ΠΟΥ ΕΠΗΡΕΑΖΟΥΝ ΤΗ ΦΘΟΡΑ ΤΩΝ ΟΠΩΡΟΚΗΠΕΥΤΙΚΩΝ Αναπνοή Η λειτουργία.

Supplementary Figure S1 a

T+3 WL kDa pI Supplementary Fig. 1.　Confirmation of the.

Supplementary Figure S1, Lecoeur et al.

Rupp et al. Supplementary Figure 1: Structure of the human troponin T gene Exon 6 Genomic DNA cDNA from mRNA mutation Exon 9 Exon bp Parts of genomic.

From: Comparison of High-Resolution Melting Analysis with Denaturing High-Performance Liquid Chromatography for Mutation Scanning in the ABCA4 Gene Invest.

(B.P :51) ( B:P52 ).

Supplementary Figure 1 Shiota et al.

10X dilution x ~10nM full – length competitor

Nonsense Mutations Inhibit RNA Splicing in a Cell-Free System: Recognition of Mutant Codon Is Independent of Protein Synthesis Said Aoufouchi, José Yélamos,

Calcium regulates ERK nuclear association, but not its activation.

Matrix pH elevations propagate along connected, but not fused, mitochondria. Matrix pH elevations propagate along connected, but not fused, mitochondria.

Data analysis of thermal proteome profiling

اثرات گرمايش جهاني تغييرات آب و هوا، تأثيرات عميق و شديدي بر بسياري از عوامل اساسي موثر بر سلامت از جمله : آب، غذا، هوا و محيط زيست دارد كه اين مورد خود.

NM1 localizes in nucleoli and is required for Pol I transcription.

NG2-CreERT2 postnatal day 31

Figure 1 Immunofluorescence pattern of patient septin-5-immunoglobulin G binding to mouse tissues Immunofluorescence pattern of patient septin-5-immunoglobulin.

[68Ga]Pentixafor PET imaging of MM xenografts Real‐time PCR analysis of cxcr4 transcript expression levels in HeLa (negative control) and in MM cell lines.

Peixoto et al, Supplementary Figure 4.1 A(top)

CMTR1 methyltransferase stimulates DHX15 helicase activity.

End point Net change with soy supplements vs control (95% CI) p

Self Replicating Biochemical Systems

Supplementary Figure 4. Comparisons of MethyLight and gene expression data. PMR values (X-axis) were plotted against log2 gene expression values (Y-axis)

Sequencing at 10,000x using Illumina paired reads

Figure 3 Transcripts of the splicing mutation (c

Ben B. Hopkins, Tanya T. Paull Cell

Volume 28, Issue 1, Pages (October 2007)

Lutz et al, Neuropsychopharmacology

a c b d e * * －＋ Supplementary Figure 0.2 HCF (ALP / G3PDH) 0.1 SK-1

Supplementary Figure S5, Lecoeur et al.

Relative protein levels

Helena M. Viola et al. BTS 2018;3:

Life expectancy and baseline BP: Male participants

Supplementary Figure 2 Shiota et al.

Roth et al, Supplementary Figure 1

CMTR1 interacts with DHX15.

CMTR1 methyltransferase activity is repressed by DHX15.

Chemotherapeutic Drug Combination Index Description

Targeted Exon Skipping Restores Type VII Collagen Expression and Anchoring Fibril Formation in an In Vivo RDEB Model Sandrina Turczynski, Matthias Titeux,

Various dendritic structures formed from a solution of protein 288 and NaCl. Various dendritic structures formed from a solution of protein 288 and NaCl.

Amanda Solem, Nora Zingler, Anna Marie Pyle Molecular Cell

ZBTB48 is required for MTFP1 expression

The CHCH domain is necessary for mitochondrial import of CHCHD10

Volume 54, Issue 6, Pages (June 2014)

Structure, localization, and ER exit of RUSH reporter proteins.

Enhanced expression of TLR7 protein in PBMCs from women.

Figure 2 DNM1 mutations inhibit transferrin uptake Inhibition of transferrin internalization in mammalian cell lines. DNM1 mutations inhibit transferrin.

Activation of PKR by the PBM decoy peptide.

Distribution of phosphosites and PDGFRα activity in primary cultures.

ZFAND5 stimulates proteasomes and promotes overall protein degradation in MEF, HeLa, and HEK293 cells. ZFAND5 stimulates proteasomes and promotes overall.

Figure 4 DNM1 mutations affect protein levels and self-dimerization (A) HeLa cells were transfected with green fluorescent protein (GFP)-tagged mutant.

Detection of gene recombination in endoxifen- or Adeno-Cre-induced tumours. Detection of gene recombination in endoxifen- or Adeno-Cre-induced tumours.

The FRAP mobility of EGFP-UAP56, but not its K95N mutant, is ATP-dependent. The FRAP mobility of EGFP-UAP56, but not its K95N mutant, is ATP-dependent.

Conversion of proBDNF to mature BDNF occurs after the first pairing session of conditioning as shown by Western blot analysis. Conversion of proBDNF to.

Table 1. Measurement of ring diameters of proteins localizing in ring-like patterns around centrioles.Consideration of the size of IgG (about 8 nm) raises.

WT MARCH8, but not the CS mutant, specifically ubiquitinates and downregulates TfR. WT MARCH8, but not the CS mutant, specifically ubiquitinates and downregulates.

4E-BP is present in an 80 kDa complex in unfertilized eggs.

Rene L. Begay et al. BTS 2016;1: Affected Individuals Carry a Mutation at the Intronic Border of Exon 43 (A) Sanger sequenced chromatogram of healthy.

Western blotting for GluR1.

Supplement Figure 1 Untreated Thermal IMDP CPLL Untreated Thermal IMDP

111In-CHX-A”-DTPA hu3S193 diabody was analyzed by FPLC for its serum stability properties: A, in 5% human serum albumin at 0 h after incubation; B, in.

**** *** * **** **** *** Shahriary et al.- Supplementary Figure 4 (a)

Presentation transcript:

HeLa COS-7 Supplementary Figure S1 Coelho et al (2014) MM pSPL3 MM 800 bp 500 bp 700 bp 450 bp 600 bp 400 bp 500 bp 350 bp 400 bp 300 bp 300 bp 250 bp HeLa COS-7 Supplementary Figure S1 Coelho et al (2014)

Supplementary Figure S2 Coelho et al (2014) gtcagtctcccaggtaggatcctggggc exon 8 exon 9 3’- gtccatcctaggacc - 5’ LNA1 10 nt gtcagtctcccaggtaggatcctggggc exon 8 exon 9 3’- agagggtccatcctag - 5’ LNA2 5 nt Supplementary Figure S2 Coelho et al (2014)

Supplementary Figure S3 Coelho et al (2014) -LNA +LNA1 (0.5 μM) MM 400 bp 300 bp Supplementary Figure S3 Coelho et al (2014)

A B C Supplementary Figure S4 Coelho et al (2014) p.D274Gfs*17 WT ~45 kDa ~35 kDa B C Supplementary Figure S4 Coelho et al (2014)

Denatured protein (normalized) Aggregated protein (normalized) (mdeg.cm-2.dmol-1) [θ] Denatured protein (normalized) a a b b B T (°C) λ (nm) T (°C) C b b a Aggregated protein (normalized) Aggregated protein (normalized) a D T (°C) Time (min) Supplementary Figure S5 Coelho et al (2014)