Welcome to Jeopardy!.

Slides:



Advertisements
Similar presentations
© Mark E. Damon - All Rights Reserved Another Presentation © All rights Reserved
Advertisements

TOPIC How Much Do You Remember? Directions: Scroll through the presentation and enter the answers (which are really the questions) and the questions.
Protein Synthesis $100 $200 $300 $400 $500 $100$100$100 $200 $300 $400 $500 Central Dogma Basics Transcription RNA Mutations FINAL ROUND Translation.
© Mark E. Damon - All Rights Reserved Another Presentation © All rights Reserved
© Mark E. Damon - All Rights Reserved Another Presentation © All rights Reserved
How Proteins are Made. I. Decoding the Information in DNA A. Gene – sequence of DNA nucleotides within section of a chromosome that contain instructions.
Transcription.
Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.
VII RNA and Protein Synthesis
Protein Synthesis 12-3.
Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis
RNA and Protein Synthesis. Write these terms in your journal Ribosome — makes proteins Ribosome — makes proteins RNA polymerase — enzyme that puts together.
RNA and Protein Synthesis
12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.
Transcription and Translation How genes are expressed (a.k.a. How proteins are made) Biology.
© Mark E. Damon - All Rights Reserved Another Presentation © All rights Reserved
© Mark E. Damon - All Rights Reserved Another Presentation © All rights Reserved
© Mark E. Damon - All Rights Reserved Another Presentation © All rights Reserved
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
© Mark E. Damon - All Rights Reserved Another Presentation © All rights Reserved
RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…
© Mark E. Damon - All Rights Reserved Add © All rights Reserved Your Name Topic of Game.
RNA and Protein Synthesis
Chapter 13.1: RNA Essential Questions
Welcome to Jeopardy! Retrieved from Hillgrove High School, Cobb County Schools, Georgia.
Welcome to Jeopardy!.
Transcription and Translation
PROTEIN SYNTHESIS CHAPTER 10 section 4
RNA & Protein synthesis
How to Make a Protein?.
Transcription Part of the message encoded within the sequence of bases in DNA must be transcribed into a sequence of bases in RNA before translation can.
Welcome to Jeopardy!.
Transcription and Translation
Chapter 11: From DNA to Protein
RNA February 3rd/4th, 2009.
Transcription and Translation
RNA Ribonucleic Acid.
Welcome to Jeopardy!.
Welcome to Jeopardy!.
Welcome to Jeopardy!.
How Proteins are Made.
Welcome to Jeopardy!.
12-3 RNA and Protein Synthesis
Welcome to Jeopardy!.
Welcome to Jeopardy!.
Welcome to Jeopardy!.
Welcome to Jeopardy!.
Nucleic Acids: RNA Ribonucleic Acid: RNA
Welcome to Jeopardy!.
Welcome To Jeopardy!.
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Welcome to Jeopardy!.
Welcome to Jeopardy!.
12-3 RNA and Protein Synthesis
Welcome to Jeopardy!.
Steps of Translation.
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Welcome to Jeopardy!.
Copyright Pearson Prentice Hall
Welcome to Jeopardy!.
Protein Synthesis.
12-3: RNA and Protein Synthesis (part 1)
Presentation transcript:

Welcome to Jeopardy!

Another Presentation © 2001 - All rights Reserved Mark E. Damon markedamon@hotmail.com

Directions: Scroll through the presentation and enter the answers (which are really the questions) and the questions (which are really the answers). Enter in the categories on the main game boards. As you play the game, click on the TEXT DOLLAR AMOUNT that the contestant calls, not the surrounding box. When they have given a question, click again anywhere on the screen to see the correct question. Keep track of which questions have already been picked by printing out the game board screen and checking off as you go. Click on the “Game” box to return to the main scoreboard. Enter the score into the black box on each players podium. Continue until all clues are given. When finished, DO NOT save the game. This will overwrite the program with the scores and data you enter. You MAY save it as a different name, but keep this file untouched!

Final Jeopardy Round 1 Round 2

RNA Genetic Code Protein Synthsis1 Protein Synthsis2 Diagrams Subject 6 Round 2 $100 $100 $100 $100 $100 $100 Final Jeopardy $200 $200 $200 $200 $200 $200 Scores $300 $300 $300 $300 $300 $300 $400 $400 $400 $400 $400 $400 $500 $500 $500 $500 $500 $500

What does the r in rRNA stand for? $100 What does the r in rRNA stand for?

$100 ribosomal Scores

$200 What does tRNA do?

Brings amino acids to the ribosomes $200 Brings amino acids to the ribosomes Scores

What is the name of the five-carbon sugar found in RNA? $300 What is the name of the five-carbon sugar found in RNA?

$300 Ribose Scores

What is the message in mRNA? $400 What is the message in mRNA?

The code for making a specific protein/polypeptide $400 The code for making a specific protein/polypeptide Scores

Name two structural differences between RNA and DNA. $500 Name two structural differences between RNA and DNA.

RNA – ribose, uracil, 1 strand DNA – deoxyribose, thymine, 2 strands $500 RNA – ribose, uracil, 1 strand DNA – deoxyribose, thymine, 2 strands Scores

Three sequential bases on mRNA is called a(n) _______ $100 Three sequential bases on mRNA is called a(n) _______

$100 codon Scores

Three sequential bases on tRNA is called a(n) _________ $200 Three sequential bases on tRNA is called a(n) _________

$200 anticodon Scores

Name one of the stop codons $300 Name one of the stop codons

$300 UGA, UAG, UAA Scores

Daily Double

$400 A section of DNA that codes for an entire protein is called a(n) _______

$400 gene Scores

$500 AUG is not only the start codon, it also codes for an amino acid called _______

$500 Methionine Scores

In what part of the cell does transcription take place? $100 In what part of the cell does transcription take place?

$100 Nucleus Scores

The monomers of RNA are called $200 The monomers of RNA are called ________

$200 Nucleotides Scores

Which parts of a mRNA molecule are put together during RNA splicing? $300 Which parts of a mRNA molecule are put together during RNA splicing?

$300 Exons Scores

Name an enzyme used during transcription $400 Name an enzyme used during transcription

$400 RNA polymerase Scores

When is a gene described as being expressed? $500 When is a gene described as being expressed?

$500 When the gene is going through transcription (protein synthesis has begun) Scores

In what part of the cell does translation take place? $100 In what part of the cell does translation take place?

$100 Ribosomes/Cytoplasm Scores

$200 What do you call a section of RNA that does not code for part of a protein?

$200 Intron Scores

If the DNA code is TCA GAT, what would the sequence for mRNA? $300 If the DNA code is TCA GAT, what would the sequence for mRNA?

$300 AGUCUA Scores

The genetic code is determined by the sequence of _______ $400 The genetic code is determined by the sequence of _______

Bases/Nucleotides in DNA or RNA $400 Bases/Nucleotides in DNA or RNA Scores

$500 Describe a reason that scientists believe explains why genes contain introns

It may allow a gene to code for more than one protein. $500 It may allow a gene to code for more than one protein. Scores

In the cell diagram, what does the letter b represent? $100 In the cell diagram, what does the letter b represent?

$100 RNA Splicing Scores

In the cell diagram, what does the letter D represent? $200 In the cell diagram, what does the letter D represent?

$200 Nuclear membrane Scores

what does the letter E represent? $300 In the cell diagram, what does the letter E represent?

$300 ribosome Scores

In the translation diagram, what does the letter D represent? $400 In the translation diagram, what does the letter D represent?

$400 mRNA Scores

In the translation diagram, what does the letter F represent? $500 In the translation diagram, what does the letter F represent?

$500 tRNA Scores

$100 A protein that binds to DNA and prevents RNA polymerase from transcribing a gene

$100 Repressor Scores

What do the five genes in the trp operon code for? $200 What do the five genes in the trp operon code for?

Five enzymes that are needed to synthesize tryptophan $200 Five enzymes that are needed to synthesize tryptophan (an amino acid) Scores

$300 These genes determine the patterning of the body axis. They determine where limbs and body segments will grow in an embryo.

$300 Hox genes (homeobox genes) Scores

$400 A group of genes and their control sequences that are expressed together in prokaryotic cells is called

$400 Operon Scores

$500 When the repressor is normally in the active form and gene is usually turned off, this refers to a(n) ________ system

$500 Inducible Scores

Subject 1 Subject 2 Subject 3 Subject 4 Subject 5 Subject 6 Round 1 $200 $200 $200 $200 $200 $200 Final Jeopardy $400 $400 $400 $400 $400 $400 Scores $600 $600 $600 $600 $600 $600 $800 $800 $800 $800 $800 $800 $1000 $1000 $1000 $1000 $1000 $1000

$200 Enter Answer Here for Category 1 - Question 1

Enter Question Here for $200 Enter Question Here for Category 1 - Question 1 Scores

$400 Enter Answer Here for Category 1 - Question 2

Enter Question Here for $400 Enter Question Here for Category 1 - Question 2 Scores

$600 Enter Answer Here for Category 1 - Question 3

Enter Question Here for $600 Enter Question Here for Category 1 - Question 3 Scores

$800 Enter Answer Here for Category 1 - Question 4

Enter Question Here for $800 Enter Question Here for Category 1 - Question 4 Scores

$1000 Enter Answer Here for Category 1 - Question 5

Enter Question Here for $1000 Enter Question Here for Category 1 - Question 5 Scores

$200 Enter Answer Here for Category 2 - Question 1

Enter Question Here for $200 Enter Question Here for Category 2 - Question 1 Scores

Daily Double

$400 Enter Answer Here for Category 2 - Question 2

Enter Question Here for $400 Enter Question Here for Category 2 - Question 2 Scores

$600 Enter Answer Here for Category 2 - Question 3

Enter Question Here for $600 Enter Question Here for Category 2 - Question 3 Scores

$800 Enter Answer Here for Category 2 - Question 4

Enter Question Here for $800 Enter Question Here for Category 2 - Question 4 Scores

$1000 Enter Answer Here for Category 2 - Question 5

Enter Question Here for $1000 Enter Question Here for Category 2 - Question 5 Scores

$200 Enter Answer Here for Category 3 - Question 1

Enter Question Here for $200 Enter Question Here for Category 3 - Question 1 Scores

$400 Enter Answer Here for Category 3 - Question 2

Enter Question Here for $400 Enter Question Here for Category 3 - Question 2 Scores

$600 Enter Answer Here for Category 3 - Question 3

Enter Question Here for $600 Enter Question Here for Category 3 - Question 3 Scores

$800 Enter Answer Here for Category 3 - Question 4

Enter Question Here for $800 Enter Question Here for Category 3 - Question 4 Scores

$1000 Enter Answer Here for Category 3 - Question 5

Enter Question Here for $1000 Enter Question Here for Category 3 - Question 5 Scores

$200 Enter Answer Here for Category 4 - Question 1

Enter Question Here for $200 Enter Question Here for Category 4 - Question 1 Scores

$400 Enter Answer Here for Category 4 - Question 2

Enter Question Here for $400 Enter Question Here for Category 4 - Question 2 Scores

Daily Double

$600 Enter Answer Here for Category 4 - Question 3

Enter Question Here for $600 Enter Question Here for Category 4 - Question 3 Scores

$800 Enter Answer Here for Category 4 - Question 4

Enter Question Here for $800 Enter Question Here for Category 4 - Question 4 Scores

$1000 Enter Answer Here for Category 4 - Question 5

Enter Question Here for $1000 Enter Question Here for Category 4 - Question 5 Scores

$200 Enter Answer Here for Category 5 - Question 1

Enter Question Here for $200 Enter Question Here for Category 5 - Question 1 Scores

$400 Enter Answer Here for Category 5 - Question 2

Enter Question Here for $400 Enter Question Here for Category 5 - Question 2 Scores

$600 Enter Answer Here for Category 5 - Question 3

Enter Question Here for $600 Enter Question Here for Category 5 - Question 3 Scores

$800 Enter Answer Here for Category 5 - Question 4

Enter Question Here for $800 Enter Question Here for Category 5 - Question 4 Scores

$1000 Enter Answer Here for Category 5 - Question 5

Enter Question Here for $1000 Enter Question Here for Category 5 - Question 5 Scores

$200 Enter Answer Here for Category 6 - Question 1

Enter Question Here for $200 Enter Question Here for Category 6 - Question 1 Scores

$400 Enter Answer Here for Category 6 - Question 2

Enter Question Here for $400 Enter Question Here for Category 6 - Question 2 Scores

$600 Enter Answer Here for Category 6 - Question 3

Enter Question Here for $600 Enter Question Here for Category 6 - Question 3 Scores

$800 Enter Answer Here for Category 6 - Question 4

Enter Question Here for $800 Enter Question Here for Category 6 - Question 4 Scores

$1000 Enter Answer Here for Category 6 - Question 5

Enter Question Here for $1000 Enter Question Here for Category 6 - Question 5 Scores

Final Jeopary Question Jeopardy Enter Category Final Jeopary Question Scores

Enter Answer Here for Final Jeopardy

Enter Question Here for Final Jeopardy Scores