DNA Mutations.

Slides:

Advertisements

Similar presentations

Mutations Hollywood’s images of mutation. Mutations Hollywood’s images of mutation.

Advertisements

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

14.4 Gene Mutations. What is a Mutation? A mutation is any change in the amount or structure of the DNA of an organism. KEY POINT: If this occurs in somatic.

Genes and mutations. What are genes? A molecular unit of heredity The name for stretches of DNA and RNA that code for a specific protein (which has a.

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

Mutations Chapter 12.4.

Genetic Changes 11.3.

Mutations 13.3.

Mutations Genetic Changes.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.

MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.

MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.

Sometimes replication, transcription and translation don’t go as planned! Replication, Transcription, and Translation errors result in mutations. A mutation.

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

Mutation Notes: Chapter 11.

The Cell Cycle.

Gene Expression and Regulation and Mutations

Section 11.3: Genetic Changes

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

A mutation is a change in an organism’s DNA.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Copyright Pearson Prentice Hall

Mutations Add to Table of Contents – p. 14

MUTATIONS And their effect.

Sometimes replication, transcription and translation don’t go as planned! Replication, Transcription, and Translation errors result in mutations. A mutation.

Genetic Mutations.

Mutations LN #23 Ms. Garcia California Content Standard Genetics

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

11.3 Section Objectives – page 296

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.

A mutation is a change in an organism’s DNA.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Some mutations affect a single gene, while others affect an entire chromosome.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mutations Ms MacCormack Fall 2018.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Mutations A mutation is any change in the DNA sequence.

Draw a conclusion from this graph for both the red and blue line

10th Grade Biology Mr. Walker

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mutation, Natural Selection, and Artificial Selection

Objective: Explain the main types of mutations

Copyright Pearson Prentice Hall

A mutation is a change in an organism’s DNA.

11.3 Section Objectives – page 296

Section 20.4 Mutations and Genetic Variation

A mutation is a change in an organism’s DNA.

Mutations: Changes in Genes

Presentation transcript:

DNA Mutations

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC What does it matter???

CACGTGGACTGAGGACTCCTC Codon for CTC = glutamate CACGTGGACTGAGGACACCTC Codon for CAC = valine What does it matter???

Mutation = any change in a DNA sequence usually happens during DNA replication in sex cells, it may affect individual’s offspring/children in body cells, it may affect the individual

Mutations can: - be bad, leading to cancer, aging, birth defects, self-aborted embryos

be good, making an organism survive better in its environment Example: bacteria becoming antibiotic-resistant The ability to drink milk as an adult is a helpful mutation.

have no effect Example: CAC = valine CAT =

Types of Mutations gene mutations – only affects one gene a. point mutation - a substitution of a single base pair - changes only one amino acid (if any!)

Types of Mutations frameshift mutation - a single base is added or deleted - changes every amino acid after mutation site - also called a nonsense mutation http://highered.mcgraw-hill.com/sites/0072552980/student_view0/chapter9/animation_quiz_5.html

Types of Mutations 2. Chromosomal mutation – may affect more than one gene Examples: nondisjunction, deletion, insertion, inversion, translocation

What can cause a mutation? ***A mutation can be inherited, caused by environmental agents, or happen spontaneously Mutagen – anything environmental that can cause a change in DNA

Mutagens  Radiation – UV, X-rays, nuclear

Mutagens  Chemicals – asbestos, formaldehyde, chemicals in tobacco products (many mutagens are also carcinogens – cancer causing)

Mutation Repair Note: Our DNA mutates all the time, but our cells have repair mechanisms. It is the overexposure to a mutagen that causes the worst problems, because the cell cannot repair all of it in time. Also, repair effectiveness reduces with age.