Copyright Pearson Prentice Hall 12–1 DNA Photo credit: Jacob Halaska/Index Stock Imagery, Inc. Copyright Pearson Prentice Hall

The Components and Structure of DNA Review of Nucleic Acids Function: Nucleic acids store and transmit genetic information. Examples: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA contains the sugar deoxyribose. RNA contains the sugar ribose. Building Blocks / Monomers: nucleotides. Individual nucleotides can be joined by covalent bonds to form nucleic acids. Copyright Pearson Prentice Hall

The Components and Structure of DNA The Double Helix  James Watson and Francis Crick discovered that DNA is in the shape of a double helix (like a twisted ladder). Copyright Pearson Prentice Hall

The Components and Structure of DNA There are four nitrogenous bases in DNA: adenine guanine cytosine thymine DNA is made up of nucleotides. Each nucleotide has three parts: a deoxyribose molecule, a phosphate group, and a nitrogenous base. There are four different bases in DNA: adenine, guanine, cytosine, and thymine. Copyright Pearson Prentice Hall

The Components and Structure of DNA The backbone of a DNA chain is formed by the sugar and phosphate groups of each nucleotide. The nucleotides can be joined together in any order to make a strand of DNA. DNA is made up of nucleotides. Each nucleotide has three parts: a deoxyribose molecule, a phosphate group, and a nitrogenous base. There are four different bases in DNA: adenine, guanine, cytosine, and thymine. Copyright Pearson Prentice Hall

The Components and Structure of DNA Chargaff's Rules Erwin Chargraff discovered that in any DNA molecule: the amount of guanine [G] and cytosine [C] is almost the same, and the amount of adenine [A] is almost the same as the amount of thymine [T]. Therefore, according to Chargraff’s Rules: A = T and G = C Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall For example: ATTAGCTAGCTCATCGATCG pairs with TAATCGATCGAGTAGCTAGC Copyright Pearson Prentice Hall

The Components and Structure of DNA DNA Double Helix DNA is a double helix in which two strands are wound around each other. Each strand is made up of a chain of nucleotides. The two strands are held together by hydrogen bonds between adenine and thymine and between guanine and cytosine. Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall Chromosome Structure Chromosomes – rod-shaped structure, usually found in pairs in a cell nucleus. A chromosome carries the genes, segments of DNA that have the directions (code) to make a protein, that determine gender and the characteristics an organism inherits from its parents. Copyright Pearson Prentice Hall