Mutations.

Slides:

Advertisements

Similar presentations

Changes to the Genetic Code

Advertisements

14.4 Gene Mutations. What is a Mutation? A mutation is any change in the amount or structure of the DNA of an organism. KEY POINT: If this occurs in somatic.

Mutations. Mutation  Permanent changes or errors in a DNA sequence  Copied during DNA replication  Therefore heritable  OR may occur during transcription.

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.

Point Mutations Silent Missense Nonsense Frameshift.

the Genetic Code Shown as mRNA 5′ → 3′ 64 codons Redundant

1 Genetic code: Def. Genetic code is the nucleotide base sequence on DNA ( and subsequently on mRNA by transcription) which will be translated into a sequence.

Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Mutations. I. Mutations -any change in DNA sequence (order of nucleotides) is a mutation. -mutations can occurr during DNA replication, transcription,

Unit 6 Notes: Mutations. DNA Mutations Mutations: Any change in the sequence of nitrogenous bases of DNA. Causes: – Mutagens = factors that change chemical.

Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.

The Cell Cycle.

Warm Up In your notes, Transcribe this DNA code: DNA: TAC CGT TCA ACT mRNA: AUG GCA AGU UGA ….and translate: Amino acids: methionine-alanine-serine-stop.

DNA/GENE MUTATIONS.

Chromosomal Disorders

BIOLOGY 12 Mutations.

Mutations and Nature vs. Nurture.

Gene Mutations.

- And its affect on Protein synthesis

Gene Mutations.

Types of Mutations.

Gene Mutations Chapter 11.

Daily Warm-Up Dec. 17th What is a genetic mutation? Homework:

What happens when things go wrong?

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Types of point mutations

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

Mutations (Section 17-5) Now, that you know how gene expression works, let’s see how changes in the gene affect how the protein is made.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

DNA MUTATIONS A mutation is a change in the DNA code.

Mutations Section 12-4.

Distinguish between codon and anticodon.

Ch 12-4 Genetic Mutations.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

Chapter 12-4 DNA Mutations.

Mutation Notes.

Mutations Notes.

Section 20.4 Mutations and Genetic Variation

Presentation transcript:

Mutations

Mutations: A change in the nucleotide sequence of a gene

Frameshift Mutation Caused by insertions (additions) or deletions of nucleotides in DNA Result  drastically altered protein (possibly non-functional!)

TAC AGT TTC AAT ATT TAC AGT TTC TAA TAT T AUG UCA AAG AUU AUA A mRNA codons are shifted! (c) Methionine – Serine – Lysine – Isoleucine - Isoleucine

Point Mutations Involve change in a single nucleotide (changes a specific codon) Silent Mutation: A changed codon still codes for the correct amino acid Ex. UUA  UUG still codes for leucine

(b) Nonsense Mutation: Substitution occurs early on in protein chain  malfunctioning protein Ex. UCG  UAG “stop” codon

(c) Missense Mutation: Single amino acid is changed  may not have such a drastic effect Ex. CCG  CAG (mRNA) CCG = proline CAG = glutamine * Single change to 150 amino acid protein may have little effect

Mutagens Environmental: Substances in the environment that cause mutations to DNA Radiational: Ex. Radioactive substances, X-Rays or UV radiation Chemical: Cigarette smoke, pesticides, pollutants

2 Types of Mutations Somatic Germinal Occurs in body cell (not including reproductive cells… eggs or sperm) Mutation occurs in reproductive cells (eggs & sperm) Can lead to evolutionary change!!