10th Grade Biology Mr. Walker

Slides:

Advertisements

Similar presentations

Chapter 13.3 (Pgs ): Mutations

Advertisements

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

Section DNA: The Molecule of Heredity

Mutations and Karyotyping

 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,

MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

Mutations Chapter 12.4.

Genetic Changes 11.3.

DNA and Genes Chapter DNA: The Molecule of Heredity Objectives Analyze the structure of DNA Determine how the structure of DNA enables it to.

Mutations Genetic Changes.

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

Gene Mutations Chapter 11.

Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.

Section 11.3 Genetic Changes.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.

DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.

Mutations that happen during Transcription and Translation

DNA Mutations What is a gene mutation? Often times, parts of DNA will have a base (or more) missing, added, or incorrect Can be caused by: errors in.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.

From DNA to Protein. Proteins Proteins are complex 3D structures that play a key role in cell function. All controlling enzymes are made out of protein.

Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.

MUTATIONS Intro video

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.

Mutations. We all make mistakes. Sometimes cells make mistakes, too -- -like when they copy their DNA.

Mutation Notes: Chapter 11.

11.3 Mutations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Chapter 8 Notes/ DNA and RNA

A change in the DNA sequence that affects genetic information

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Mermaid Syndrome Video.

Gene Mutations Chapter 11.

Mutations Add to Table of Contents – p. 14

Genetic Mutations.

Protein Synthesis.

A change in the DNA sequence that affects genetic information

Chapter 13: Genes & Chromosomes

To be successful today…

11.3 Section Objectives – page 296

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.

Mutations: a mistake made in DNA

Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.

4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.

Mutations A mutation is any change in the DNA sequence.

Gene and Chromosomal Mutations

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Genetic Mutations Karyotype: the number and visual appearance of the chromosomes in the cell nuclei of an organism or species.

Mutations A mutation is any change in the DNA sequence.

Draw a conclusion from this graph for both the red and blue line

1) Base Mutations 2) Chromosomal Mutations

Genetic Mutations.

Mutation, Natural Selection, and Artificial Selection

Objective: Explain the main types of mutations

11.3 Section Objectives – page 296

DNA Mutations Types & their effects.

Chromosomal Mutations

Presentation transcript:

10th Grade Biology Mr. Walker Mutations 10th Grade Biology Mr. Walker

Genetic Changes A mutations is any change to the DNA sequence. Chromosomal mutations Frameshift mutations Point mutations Only mutations in sex cells can be transmitted to offspring. Potentially can produce new species

Chromosomal mutations Deletions: When part of a chromosome is left out. Insertion: When part of a chromatid breaks off and attaches to its sister chromatid Inversion: When part of a chromosome breaks off and reattaches backwards Translocation: When part of one chromosome breaks off and is added to a different chromosome.

Frameshift mutations A mutations in which a single base is added to or deleted from DNA THE DOG BIT THE CAT THE DOB ITT HEC AT

Point mutations A change in a single base pair in DNA THE DOG BIT THE CAT THE DOG BIT THE CAR Tay Sachs dz

Causes of mutations Mutagens are any agent which can cause a change in DNA. Radiation X-rays UV light Chemicals like asbestos, benzene, formaldehyde

Are mutations bad?

Are mutations bad? It depends If the change causes disease (Dz). For example….. cancer If the change allows the organism to be faster, stronger, smarter? EVOLUTION BABY!