Mas-Related G-Protein Coupled Receptors and Cowhage-Induced Itch Vemuri B. Reddy, Ehsan Azimi, Lei Chu, Ethan A. Lerner  Journal of Investigative Dermatology  Volume 138, Issue 2, Pages 461-464 (February 2018) DOI: 10.1016/j.jid.2017.05.042 Copyright © 2017 The Authors Terms and Conditions

Figure 1 Mucunain activates the human receptors MRGPRX1 and human MRGPRX2. (a, c) Responses of individual cells to 300 nM mucunain added at the arrow. (b, d) Concentration effect curves for mucunain on MRGPRX1 (EC50 0.50 μM) and MRGPRX2 (EC50 0.11), respectively. For (a) and (b), HEK-293 cells were transiently transfected with a cDNA encoding the human receptor MRGPRX1. For (b) and (d), an HEK-293 cell line was engineered to stably express a cDNA encoding the human receptor MRGPRX2. Intracellular calcium [Ca2+]i was determined by ratiometric Fura-2 imaging as an indicator of receptor activation following the addition of mucunain. Mrgpr, mas-related G-protein coupled receptor. Journal of Investigative Dermatology 2018 138, 461-464DOI: (10.1016/j.jid.2017.05.042) Copyright © 2017 The Authors Terms and Conditions

Figure 2 Mucunain and cathepsin S degranulate human mast cells. The level of degranulation in the LAD-2 mast cell line was assessed by the release of β-hexosaminidase as quantified by the level of its substrate p-nitrophenyl N-acetyl-β-D-glucosamide digested in a colorimetric assay. Human MRGPRX2 mediates IgE-independent mast cell degranulation. Mucunain and cathepsin S cause degranulation. In contrast, papain, another cysteine protease, does not, as it activates MRGPRX1, not present on LAD-2 cells. Mrgpr, mas-related G-protein coupled receptor. Journal of Investigative Dermatology 2018 138, 461-464DOI: (10.1016/j.jid.2017.05.042) Copyright © 2017 The Authors Terms and Conditions

Figure 3 Mas-related G-protein coupled receptor (MRGPRX2) appears to be transcribed in human dorsal root ganglia (DRG). PCR was performed using forward and reverse primers (F+R) from the coding region (lane 2) as well as two sets of intron spanning primers (X2INTF1+X2INTR1 and X2INTF2+X2INTR2) (lanes 3 and 4) from cDNA prepared from DRG RNA (Clontech, Mountain View, CA). The solid band at 408 bp in lane 2 is consistent with MRGPRX2 being transcribed in DRGs although the possibility of contaminating mast cell RNA is acknowledged. The faint band at 383 bp in lane 3 suggests that a small amount of genomic DNA may be present in the RNA although no band was present in lane 4. Lanes 5, 6, and 7 are from genomic DNA (Promega Madison, WI) amplified with the same primers as bands 2, 3, and 4. The entire gel is presented. The primers are as follows:F: TCAGCGGTCGTGTGTGTCCTGCTCTGGGR: GAAGAAGTAAATGATGGGGTTGGCACX2INTF1:AATTCTGCACCCCCATGGAGX2INTR1: GCCTGCATTTGAACCCACAGX2INTF2: ATTAGCCAGTCGTGGTGGTGX2INTR2: CTCCATGGGGGTGCAGAATT Journal of Investigative Dermatology 2018 138, 461-464DOI: (10.1016/j.jid.2017.05.042) Copyright © 2017 The Authors Terms and Conditions