Gene Protein Genome Proteome Genomics Proteomics

Important Terms 1) Genetics is the study of biologically inherited traits or (biological heredity). 2) Inherited traits are determined by the elements (units) of heredity (genes). A gene is a region of DNA containing genetic information. 3) Genome is the total of DNA in a single cell of the organism.

4) Genomics is the latest advance in molecular genetics 4) Genomics is the latest advance in molecular genetics. It deals with the DNA sequence, organization, function, and evolution of genomes. 5) Proteome is the complete set of proteins encoded in the genome. 6) Proteomics is the study of the complement of proteins presentin a cell or organism in order to identify their cellular localization, functions, and interactions.

genotype Is the genetic constitution of a cell (organism)

phenotype Is the observable properties of an organism (including its visible traits)

Alleles? Alleles are the different forms of particular gene.

Heterozygous genotype The genotype in which the pair of alleles are different. Heterozygous متخالفة اللواقح

Homozygous genotype The genotype in which the pair of alleles are alike. Homozygous متماثلة اللواقح

Dominant trait Is that expressed in the phenotype when the genotype is either heterozygous or homozygous.

Recessive trait Is that expressed in the phenotype when the genotype is homozygous Recessive متنحية

Complementary base pairing It is the base pairing between A and T and between C and G. The complement of A is T and the complement of C is G.

RNA 1) RNA contains the sugar ribose instead of deoxyribose in DNA. 2) RNA is single stranded. 3) RNA contains the base uracil (U) instead of thymine (T) which is present in DNA.

Transcription & Translation One strand of DNA directs the synthesis of a molecule of RNA (ribonucleic acid). (this is called transcription and the RNA made is called transcript). Messenger RNA (mRNA) carries genetic information from DNA and is used as a template for polypeptide synthesis. (this is called translation). strand خيط

3Types of RNA to make protein 1) Messenger RNA which is used as a template for synthesis of protein. 2) Ribosomal RNA (rRNA) which has four types and on which polypeptide synthesis takes place. 3) Transfer RNA (tRNA): it is a set of tRNA, each of which carries a particular amino acid as well as a three-base recognition area to bind 3 adjacent bases in mRNA. 1-الحمض النووي الريبي المرسال الذي يستخدم كقالب لصنع البروتين 2-الرنا الريباسي الذي له أنواع أربعة ، والذي يأخذ مكان تجميع ببتيد 3-(الحمض الريبي النووي النقال) : وهي عبارة عن مجموعة من الحمض الريبي النووي النقال ، كل منها يحمل حمض أميني معين ، بالإضافة إلى ثلاث قواعد منطقة الاعتراف للقاعدة 3 ربط المجاورة في مرنا

Mutation Mutation refers to any heritable change in a gene or in the genetic material in general. It refers also to the process by which a change takes place. Mutant is the result of mutation. Mutant RNA, mutant DNA, mutant protein.

Sickle cell hemoglobin GAG: codon on mRNA for glutamic acid (Aa) GUG: codon on mRNA for valine (Aa) wild type mutant DNA: 5’…GAG… …GTG…3’ DNA(T): 3’…CTC… ... CAC …5’ mRNA: 5’…GAG… …GUG…3’ So glutamic acid will be replaced by valine.

1) Deduce the base sequence of the mRNA in this coding region? In the human gene for the β chain of hemoglobin, the first 21 nucleotides in the amino-acid-coding have the sequence: 3'- TACCACGTGGACTGAGGACTC -5' 1) Deduce the base sequence of the mRNA in this coding region? 2) What is the amino acid sequence in this part of β chain of hemoglobin

3'- TACCACGTGGACTGAGGACAC -5‘ What is the amino acid replacement?

Amino Acid Codon Threonine / Thr ACU Leucine / Leu CUG ACA Isoleucine / Ile AUA Histidine / His CAC Methionine / Met AUG Lysine / Lys AAG Valine / Val GUG Glutamic acid / Glu GAG Serine / Ser UCU Argenine / Arg CGG Proline / Pro CCU Trp / Tryptophan UGG CCC