DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department: Environmental & Molecular Toxicology Oregon State University

Colorectal Cancer (CRC) 2nd leading cause of cancer deaths worldwide CRC claims nearly 50,000 lives/year in U.S. American Cancer Society estimates 147,000 new cases by 2011 Individuals deficient in MMR show elevated risk and susceptibility to acquiring mutations and often developing cancer, most notably colorectal cancer. Colorectal cancer is the second leading cause of cancer deaths in the United States. Statistics claim CRC takes nearly 50,000 lives per year with estimates of 147,000 new cases by 2011, further stressing the need to learn about the cellular pathways, proteins and risk factors associated with CRC. While about 80% of CRC cases are sporadic, the remaining 20% are hereditary.

Lynch Syndrome (HNPCC) Autosomal dominant genetic condition Mutation in one or more of the 4 MMR genes: MLH1 & PMS2 (MutLα) and MSH2 & MSH6 (MutSα) MSH2 MSH6/ 3 PMS2 MLH1 Lynch Syndrome (or HNPCC) an autosomal dominant genetic condition is the most common hereditary CRC . Individuals having one or more close relatives with CRC have an increased risk from 2-fold to 6-fold. It is linked to a mutation in 4 MMR genes: MSH2, MLH1, PMS2 and MSH6, causing the cell to lack an efficient mismatch repair pathway. Tumors recognized in people with Lynch Syndrome display unique signature microsatellite instability. Microsatellites are repeated sequences of DNA. The length of these microsatellites is highly variable from person to person, however each individual has microsatellite sequences of set length. Familial members with mutations in DNA repair genes, accumulate errors in these microsatellite regions and become longer or shorter. Longer repetitive sequences are more susceptible to accumulating mutations. Individuals deficient in MMR are more susceptible to developing cancer comparatively to those with proficient MMR, especially when exposed to environmental carcinogenic compounds such as polycyclic Aromatic Hydrocarbons.

Mismatch Repair A number of cellular pathways, processes and environmental genotoxins interact to influence an individual’s susceptibility and risk for developing cancer. Apoptosis A number of cellular pathways, processes and environmental genotoxins interact to influence an individual’s susceptibility and risk to developing cancer. Among these, a mechanism referred to as MMR plays an important role in preserving genomic stability, by identifying errors in DNA replication and correcting them either directly (excision and replacement) or indirectly by inducing apoptosis or cell cycle arrest. Individuals deficient in MMR show elevated risk and susceptibility to acquiring mutations and often developing cancer.

Recognition of Mismatch ATP ADP MSH2 MSH6/ 3 MSH2 MSH6/ 3 PMS2 MLH1 DNA Mismatch Repair plays a key role in identifying errors in DNA replication. The most common error during DNA replication is the simple mispairing of nucleotide bases and is predicted to occur every one in 103-104 basepairs. The DNA strand present contains a mispaired nucleotide base, Thymine. The MutSa complex composed of MSH2/MSH6 proteins is primarily responsible for recognizing base-base mismatches whereas the MutSb heterodimeric complex with MSH2 and MSH3 proteins recognizes and bind to DNA near large insertion deletion loops resulting from slippage occurring during the replication of repetitive sequences. Upon hydrolysis of ATP to ADP, the MutS complex undergoes a confirmation change to a sliding clamp which then translocates along the DNA backbone in search of the mismatch. MutS then recruits heterodimeric complex MutL composed of PMS2 and MLH1. DNA replication error rate = 1 mispairing / 104-105 basepairs MutS heterodimer locates and binds mismatch MutL heterodimer recruited and endonuclease activated

Excision of Mismatch hEXO1 hEXO1 MSH2 MSH6/ 3 PMS2 MLH1 RPA hEXO1 hEXO1 The MutS sliding clamp initiates the activity of Exo1 (Exonuclease 1). Exonuclease1 situates itself at a nick 5’ from the mispair. As it travels towards the mismatch containing thymine, it degrades the stretch of nucleotides (usually several hundred). After degradation of the nascent strand, the remaining strand of DNA is stabilized by RPA (Replication Protein A) protecting the single strand until promotion of Polymerase Delta. Exonuclease1 Activity: 5’  3’ directed RPA (Replication Protein A) Binds ssDNA, prevents degradation, promotes Polymerase δ,

Correction of Mismatch Pol δ/ε RFC PCNA RPA c Repair DNA synthesis of the strand and correct base is accomplished by PCNA (Proliferating Cell Nuclear Antigen), RFC (Replication Factor C), polymerase delta and in some cases polymerase epsilon. The presence of all three proteins is necessary for efficient activity. RFC acts as a clamp loader and loads PCNA, the DNA clamp to the DNA strand. Together the two protein complexes hold polymerase delta securely in place. Polymerase delta then fills in the remaining single-stranded gap and DNA ligase seals the remaining nick. DNA Ligase Nick PCNA = Proliferating Cell Nuclear Antigen RFC = Replication Factor C Pol δ/ε = DNA Polymerase Delta/Epsilon

Mutator Phenotype Mutations are a driving force behind cancer development Mutated MMR genes MLH1 Aberrant MMR proteins Replication errors bypass defective MMR systems Enhanced proliferation Mutations inactivate tumor suppressor genes and enable onco-genes (APC gene) Mutated cells divide A mutation in this sense is defined as any change in the nucleotide sequence of cellular DNA. A mutation in a gene responsible for preserving genomic stability would result in a cascade of downstream mutation events. A mutated MLH1 gene for instance would result in a mutated MMR protein. Thus base-base mismatches and insertion deletion loops would bypass deficient MMR systems. As mutations are not repaired, they accumulate and cause other mutations, inactivating tumor suppressor genes and enabling onco-genes. Mutated cells divide ultimately resulting in enhanced proliferation and tumorigenesis. When normal cells are damaged beyond repair, they are eliminated by apoptosis. Cancer cells avoid apoptosis and continue to multiply in an unregulated manner. To further understand the mutator phenotype phenomena, this flowchart illustrates the accumulation of mutation over a time frame of 20 years. DNA damage is first initiated by environmental or endogenous forces from which DNA damage repair mechanisms are expected to repair. Inability to repair mutations results in further downstream mutations and eventually repetitive selection for mutants and mutators. By the time the malignant phenotype has been identified clinically, many chemotherapeutic drugs are ineffective and the tumor has developed a clonal advantage over normal cells. Earlier detection of novel molecular markers and mutated cancer cells themselves could delay the accumulation of mutation. Coupled with early detection, drugs that target mutator pathways and specific genes could become efficacious in delaying malignant tumor growth. unchecked growth loss of apoptotic ability acquisition of metastic ability resistance to chemotherapeutic agents (6-TG, MNNG, 5-FU)

PAHs – The Environmental Influence Mutagenic and carcinogenic - large nonpolar compounds Exposure: diet, smoking, grilling food, fossil fuel processing Metabolized forming highly reactive diol epoxides (DE) Benzo[a]pyrene is metabolically activated to benzo[a]pyrene diol epoxide (BPDE) which binds to DNA forming bulky DNA adducts PAH’s are a class of large nonpolar compounds resulting from the incomplete combustion of organic material. Human exposure can result from diet, smoking, grilling food, fossil fuel processing and diesel exhaust fumes. These nonpolar PAHs easily cross through the cell membrane where they are metabolized forming highly reactive diol epoxides (DE). The most common PAH, Benzo[a]pyrene is metabolically activated to benzo[a]pyrene diol epoxide (BPDE) which then binds to DNA forming DNA-adducts. Thus disrupting DNA replication and inducing increased mutation frequency.

Big Question Global Hypothesis Specific combinations of environmental exposures and cellular deficiencies interact to influence cancer risk in individuals Specific Hypothesis MMR is a key pathway for reducing deleterious consequences (mutations) from PAH exposure Prediction Cells lacking MMR will show increased PAH-induced mutation

3 Questions: 1.) General phenomena of MMR-deficiency? 2.) What are the extra mutations induced? 3.) General phenomena of PAH’s, in complex mixtures?

Hypothesis We hypothesize that results seen with HCT 116 lines do reflect differences in MMR status rather than other potential known or unknown differences in the cell lines. -Verify using DLD1 cell lines proficient and deficient in MSH6 We hypothesize that MMR-dependent suppression of BPDE-induced mutations represent a phenomenon generalizable to other PAH’s, including environmentally relevant complex mixtures. We hypothesize that results seen with HCT 116 lines do reflect differences in MMR status rather than other potential known or unknown differences in the cell lines. This hypothesis can be addressed using DLD1 colon cancer cell lines, proficient and deficient in a different MMR protein MSH6. Inconsistent results between the HCT 116 and DLD1 lines would indicate that there are additional factors affecting the MF and cytotoxicity results.

BPDE-Induced Mutation Forward mutations induced by exposure to PAH’s are measured using the reporter gene hypoxanthine-guanine phosphoribosyl transferase (HPRT) 657bp 1 hour BPDE exposure Doses: 0, 25, 50, 100 nM HPRT+ HPRT- Clear pre-existing mutants HAT media – 5 passages Bulky PAH-DNA adducts Gene HPRT- Protein HPRT+/- Forward mutations induced by exposure to PAH’s are measured using the reporter gene hypoxanthine-guanine phosphoribosyl transferase (HPRT), as in previous experiments in the Buermeyer laboratory with BPDE. The HPRT enzyme plays an important role in DNA synthesis. MMR-deficient and MMR-proficient cell lines will first be cleared of preexisting HPRT mutants, followed by exposure to increasing concentrations of PAH to create PAH-DNA adducts. Cell cultures subsequently will be grown in selective culture medium containing the nucleotide analog 6-thioguanine, which is toxic to non-mutant HPRT+ cells. Growth in selective medium will allow for the HPRT-mutant cells to survive and develop into colonies. From these colonies, PAH-induced mutant frequencies can be calculated and compared between MMR-proficient and MMR-deficient cells. Grown 8 days to insure no HPRT+ protein present HPRT- mutant cells survive in 6-Thioguanine selective media HPRT+ HPRT-

Cell Lines MMR Proficient MMR Deficient HCT 116 + Ch3 WT MLH1+ DLD1+Ch2 DLD1 WT MSH6+ MSH6-

Mutant Frequency Calculation MMR Proficient MLH1 MMR Deficient MLH1 135,000 cells 300 cells 6-TG selective media Non-selective media 135,000 cells 300 cells 6-TG selective media Non-selective media few colonies ~150 colonies more colonies ~150 colonies Mutant frequency is determined by screening a known number of cells in medium containing the selective agent 6-TG to detect mutant cells, and in medium without selective agent to determine the cloning efficiency or cell viability. After an appropriate incubation time (12-14 days), colonies are stained and counted. The mutant frequency is determined from the number of colonies formed in selective medium and normalized using the number of viable colonies formed in the non selective media. MF=6-TG resistant colonies formed/(PE x # of plates) MF=mutant frequency PE = plating efficiency

Results: PAH-induced mutation in MSH6- deficient cells, similar to previous MMR+ proficient cells Technical issue with low plating efficiency in MSH6+

Mutation Identification v 2 3 4 6 7 8 9 10 11 12 2 3 4 5 6 trypsinized cloning disc RNA was extracted from HCT 116+Ch2 cells using trypsinized cloning discs. The disc and mutant colony were both moved to a 12-well plate. Upon confluency, the clone was expanded into a 6-well plate from which it was then centrifuged into a pellet. The pellets were purified using spin technology. Samples are first lysed and then homogenized. Ethanol is added to the lysate to provide ideal binding conditions. The lysate is then loaded onto the RNeasy silica membrane (see figure "RNeasy Mini spin column"). RNA binds, and all contaminants are efficiently washed away. Pure, concentrated RNA is eluted in water. Centrifuge Total RNA Purification

RNA  cDNA PCR sequence Reverse Transcriptase - PCR cDNA PCR – amplify HPRT gene Primers P3: -36 to -17 5’ CCTGAGCAGTCAGCCCGCGC 3’ P4: 701 to 682 5’ CAATAGGACTCCAGATGTTT 3’ First strand cDNA was synthesized via reverse transcript PCR. Amplification of cDNA was performed by an additional PCR step. The DNA was then quantified by agarose gel electrophoresis. Diluted primers and proper amounts of DNA was sent to the CGRB Core lab for final processing. Sequencing agarose gel electrophoresis

Agarose Gel Electrophoresis Mutant: 45 18 44 6 13 22 24 26 27 49 50 80 81 CONTROLS Batch 3 PCR Products – HCT 116+2 HPRT Mutants HPRT product 657bp

Spectrum of HPRT Mutations Spectrum Key 58.3% AT → GC transition Insertion of one nucleotide base GC → CG transversion GC → TA transversion 4.2% Deletion of one nucleotide base 25.0% GC → AT transition 12.5%

Conclusion Preliminary data suggest: BPDE-induced spectra in MLH1 deficient cells different from spontaneous mutations Too soon to tell if induced spectra differs in MMR proficient vs. deficient cell lines

Future Investigations Continue mutant analysis on remaining clones: HCT 116+Ch2 HCT 116+Ch3 DLD1 DLD1+Ch2 Complex environmental mixtures Mutant frequency Individual mutation analysis Human exposure to individual PAHs is rare, whereas exposure to mixtures of PAHs is common. Access to mixtures of PAH’s with the collaboration of Kim Anderson’s laboratory at Oregon State University could allow further research and insight on the additive, synergistic or antagonistic effects of PAHs in mixtures. Results obtained from the relationship between MMR and PAH mixtures would broaden our understanding of an individual’s susceptibility to developing cancer.

Goals Research Goals & Significance Understand MMR functions as well as genetic influences and their combined role in normal responses to carcinogens Accurate evaluation of an individuals susceptibility and risk to developing CRC Provide insight for more effective and practical CRC screening methods Develop novel models for studying other genetic and environmentally linked diseases

Acknowledgements Howard Hughes Medical Institute Environmental Health Sciences Center Dr. Andrew Buermeyer Jacki Coburn Fatimah Almousawi Kimberly Sarver Dr. Vidya Schalk Dr. Kevin Ahern, program coordinator