Transcriptional Regulation of the Murine 3′ IgH Enhancer by OCT-2

Slides:



Advertisements
Similar presentations
Volume 6, Issue 1, Pages (July 2000)
Advertisements

Implications of somatic mutations in the AML1 gene in radiation-associated and therapy-related myelodysplastic syndrome/acute myeloid leukemia by Hironori.
by Toshibumi Shimokawa, and Chisei Ra
by Hong Hao, Huiling Qi, and Manohar Ratnam
Selective Regulation of Vitamin D Receptor-Responsive Genes by TFIIH
Volume 11, Issue 6, Pages (June 2003)
A Novel Cofactor for p300 that Regulates the p53 Response
A TPR Motif Cofactor Contributes to p300 Activity in the p53 Response
MafB negatively regulates RANKL-mediated osteoclast differentiation
Daniel Chi-Hong Lin, Alan D Grossman  Cell 
Phosphorylation of NF-κB p65 by PKA Stimulates Transcriptional Activity by Promoting a Novel Bivalent Interaction with the Coactivator CBP/p300  Haihong.
Shitao Li, Lingyan Wang, Michael A. Berman, Ye Zhang, Martin E. Dorf 
The homeodomain protein Cdx2 regulates lactase gene promoter activity during enterocyte differentiation  Rixun Fang, Nilda A. Santiago, Lynne C. Olds,
Histone deacetylase 3 associates with and represses the transcription factor GATA-2 by Yukiyasu Ozawa, Masayuki Towatari, Shinobu Tsuzuki, Fumihiko Hayakawa,
Volume 6, Issue 2, Pages (February 1997)
High incidence of somatic mutations in the AML1/RUNX1 gene in myelodysplastic syndrome and low blast percentage myeloid leukemia with myelodysplasia by.
Naoko Kanda, Shinichi Watanabe  Journal of Investigative Dermatology 
Volume 87, Issue 7, Pages (December 1996)
The interferon regulatory factor ICSBP/IRF-8 in combination with PU
Volume 16, Issue 6, Pages (December 2004)
Rose-Anne Romano, Barbara Birkaya, Satrajit Sinha 
Volume 26, Issue 1, Pages (January 2007)
Arginine Methylation of STAT1 Modulates IFNα/β-Induced Transcription
I-Cheng Ho, Martin R Hodge, John W Rooney, Laurie H Glimcher  Cell 
ASK1 Is Essential for JNK/SAPK Activation by TRAF2
Phosphorylation of PML by mitogen-activated protein kinases plays a key role in arsenic trioxide-mediated apoptosis  Fumihiko Hayakawa, Martin L Privalsky 
Yongli Bai, Chun Yang, Kathrin Hu, Chris Elly, Yun-Cai Liu 
Identification and Characterization of an IκB Kinase
Human Telomerase Activation Requires Two Independent Interactions between Telomerase RNA and Telomerase Reverse Transcriptase  James R. Mitchell, Kathleen.
MUC1 Oncoprotein Stabilizes and Activates Estrogen Receptor α
Ras Induces Mediator Complex Exchange on C/EBPβ
SUMO Promotes HDAC-Mediated Transcriptional Repression
Stefanie S. Schalm, Diane C. Fingar, David M. Sabatini, John Blenis 
Volume 8, Issue 5, Pages (November 2001)
Andrew J Henderson, Ruth I Connor, Kathryn L Calame  Immunity 
Direct Interactions of OCA-B and TFII-I Regulate Immunoglobulin Heavy-Chain Gene Transcription by Facilitating Enhancer-Promoter Communication  Xiaodi.
Volume 93, Issue 7, Pages (June 1998)
Volume 93, Issue 5, Pages (May 1998)
Yuming Wang, Jennifer A. Fairley, Stefan G.E. Roberts  Current Biology 
MUC1 Oncoprotein Stabilizes and Activates Estrogen Receptor α
Volume 12, Issue 5, Pages (November 2003)
Histamine Inhibits the Production of Interferon-induced Protein of 10 kDa in Human Squamous Cell Carcinoma and Melanoma  Naoko Kanda, Shinichi Watanabe 
Naoko Kanda, Shinichi Watanabe  Journal of Investigative Dermatology 
Volume 118, Issue 1, Pages (July 2004)
Cyclooxygenase-2 Inhibitor Enhances Whereas Prostaglandin E2Inhibits the Production of Interferon-Induced Protein of 10 kDa in Epidermoid Carcinoma A431 
Keratinocyte growth factor promotes goblet cell differentiation through regulation of goblet cell silencer inhibitor  Dai Iwakiri, Daniel K. Podolsky 
Halofuginone, an Inhibitor of Type-I Collagen Synthesis and Skin Sclerosis, Blocks Transforming-Growth-Factor-β-Mediated Smad3 Activation in Fibroblasts 
Volume 6, Issue 1, Pages (July 2000)
The Basis for IL-2-Induced IL-2 Receptor α Chain Gene Regulation
Site α Is Crucial for Two Routes of IFNγ-Induced MHC Class I Transactivation: The ISRE-Mediated Route and a Novel Pathway Involving CIITA  Sam J.P Gobin,
MyoD Targets TAF3/TRF3 to Activate Myogenin Transcription
c-Src Activates Endonuclease-Mediated mRNA Decay
Volume 2, Issue 1, Pages (July 1998)
Regulation of the Expression of Peptidylarginine Deiminase Type II Gene (PADI2) in Human Keratinocytes Involves Sp1 and Sp3 Transcription Factors  Sijun.
Andrei Kuzmichev, Thomas Jenuwein, Paul Tempst, Danny Reinberg 
Volume 96, Issue 6, Pages (March 1999)
Two Functional Modes of a Nuclear Receptor-Recruited Arginine Methyltransferase in Transcriptional Activation  María J. Barrero, Sohail Malik  Molecular.
Volume 25, Issue 5, Pages (March 2007)
Yap1 Phosphorylation by c-Abl Is a Critical Step in Selective Activation of Proapoptotic Genes in Response to DNA Damage  Dan Levy, Yaarit Adamovich,
Volume 93, Issue 6, Pages (June 1998)
Hua Gao, Yue Sun, Yalan Wu, Bing Luan, Yaya Wang, Bin Qu, Gang Pei 
Rodney P. DeKoter, Hyun-Jun Lee, Harinder Singh  Immunity 
Volume 2, Issue 4, Pages (October 2002)
Volume 4, Issue 4, Pages (October 1999)
Volume 3, Issue 4, Pages (April 1999)
Volume 7, Issue 6, Pages (June 2001)
Volume 129, Issue 5, Pages (June 2007)
Volume 10, Issue 2, Pages (February 1999)
Volume 6, Issue 3, Pages (March 1997)
Acetylation Regulates Transcription Factor Activity at Multiple Levels
Presentation transcript:

Transcriptional Regulation of the Murine 3′ IgH Enhancer by OCT-2 Hong Tang, Phillip A Sharp  Immunity  Volume 11, Issue 5, Pages 517-526 (November 1999) DOI: 10.1016/S1074-7613(00)80127-2

Figure 1 Construction of 3′ IgH Enhancer Reporter Vectors and Transient Transfection Analyses (A) The wild-type enhancer reporter (pGL3-VE) contains luciferase gene (gray oval), whose expression is driven by the 5′ VH (hatched oval), and a combination of HS1/2 (dotted box), HS3 (gray box), and HS4 (open box). The conserved octamer motif within each enhancer segments (open circle) was mutagenized to octGG (cross) to yield mutant reporter pGL3-VE/1–4GG (see Experimental Procedures). The conserved octamer motif within 5′ VH was kept intact in order to facilitate analysis of “cross-talk” between the promoter and the enhancer. The reference octamer-dependent promoter reporter pGL3-VH contains the 5′ VH (hatched oval), and the octamer site was mutated to octGG (cross) analogously to yield pGL3-VH-GG. (B) Octamer dependence. pGL3-VE (3 μg; black bar) or pGL3-VE/1–4GG (3 μg; open bar) were transiently transfected into different cell lines representing developmental stages at the pre-B (HAFTL), B (WEHI 231), or mature B cell (M12, MOPC 31, MPC 11, and S194). Luciferase activities were measured 43 hr postelectroporation. Representative results were shown as the relative luciferase activity of mutant/wild-type reporter averaged from two independent transfections. (C) Comparison of the enhancer versus enhancerless reporter activity. M12 cells were transfected with 3 μg pGL3-Basic, pGL3-VH, pGL3-VE, and pGL3-VE/1–4GG, and luciferase activities were averaged from three independent assays with SD presented as error bars. Immunity 1999 11, 517-526DOI: (10.1016/S1074-7613(00)80127-2)

Figure 2 Gel Shift Analysis of Altered DNA-Binding Specificity Mutants of Oct-1RR and Oct-2RR Wild-type and RR mutant derivatives of Oct-1 and Oct-2 were produced as described (see Experimental Procedures). Lysates (4 μl) containing Oct-1 (lane 2) and Oct-1RR (lane 3) or Oct-2 (lane 4) and Oct-2RR (lane 5) were used in EMSA. The amount of Oct-1 or Oct-1RR was about two times less than Oct-2 or Oct-2RR as quantified by the incorporation efficiency of 35S-methionine in a separated in vitro translation reaction (data not shown). (A) 0.5–1 nM of octWT or (B) octGG DNA probe was used. Lane 1 was mock reactions with 4 μl reticulocyte lysates. The apparent Kd was measured in a separate experiment not shown here, and the midpoint of binding was shown. Immunity 1999 11, 517-526DOI: (10.1016/S1074-7613(00)80127-2)

Figure 3 Differential Transcription Activity of Oct-1 and Oct-2 at the 3′ IgH Enhancer (A) pGL3-VE/1–4GG (black bar) was transient transfected into M12 with pCG-FLAG-Oct-1 or pCG-FLAG-Oct-2 or with their suppressor mutants, pCG-FLAG-Oct-1RR or pCG-FLAG-Oct-2RR (hatched bars). Cells were treated with 50 μg/ml LPS overnight before being analyzed. Specific activity was derived by comparison of reporter activity of the alanine mutant proteins versus wild-type octamer binding proteins. The bottom panel represents the immunoblotting of each FLAG-tagged Oct proteins expressed under assay conditions normalized against β-galactosidase activities. (B) pGL3-VH (black bar) and pGL3-VH-GG (gray bar) were transient transfected analogously into M12, together with pCG-FLAG-Oct-1 or pCG-FLAG-Oct-2 or with their suppressor mutants, pCG-FLAG-Oct-1RR or pCG-FLAG-Oct-2RR (hatched bars). Data are presented as the relative luciferase activity of that with overexpressed Oct proteins versus with reporter vector alone. Immunity 1999 11, 517-526DOI: (10.1016/S1074-7613(00)80127-2)

Figure 4 Mitogenic Effects of LPS on M12 Cells (A) Induction of Blimp-1 expression verified by RT–PCR. M12 (lanes 1 and 2), MPC 11 (lanes 3 and 4), and S194 (lanes 5 and 6) cells were treated with 50 μg/ml LPS overnight. Blimp-1-specific cDNA (upper panel) was amplified by RT–PCR (primers: GGACTGGGTGGACATGAGAGAG/GAAGTACCCCCGTCAGCGCCG). The gel loading was normalized by the control amplification of β-actin (lower panel). (B) Time course of Oct-2RR-dependent enhancer activity in response to LPS. M12 cells were transiently transfected with pGL3-VE/1–4GG alone (triangle) or cotransfected with pGL3-VE/1–4GG and pCG-Oct-2RR (circle). Luciferase activities with LPS (filled) or without LPS (open) were measured at different time points as indicated. Immunity 1999 11, 517-526DOI: (10.1016/S1074-7613(00)80127-2)

Figure 5 Characterization of Alanine Mutants at Potential PKC Sites on Oct-2RR-Dependent Enhancer Activities (A) In vivo 32P labeling to assess phosphorylation states of wild-type and alanine mutants of Oct-2. FLAG-tagged Oct-2 (20 μg; lane 2), Oct-2-T302A (lane 3), Oct-2-S303A (lane 4), and Oct-2-T302A/S303A (lane 5) were transfected into M12 (two of 100 mm dishes) with 50 μg/ml LPS for 23 hr before immunoprecipitation. Protein loading was normalized using rabbit anti-Oct-2 serum by a separate immunoblotting (lower panel), so that equal amounts of wild-type and mutant Oct-2 proteins were used to measure the intensity of 32P incorporation (upper panel). (B) Top panel: two-dimensional phosphopeptide mapping of Oct-2 POU domains phosphorylated by PKC. His-Oct-2 POU (I), His-Oct-2 POU/302A (II), and His-Oct-2 POU/303A (III) (∼2000 cpm of each) were loaded for TLC (see Experimental Procedures). Solid arrows indicate tryptic peptides specific for T302 and/or S303; open arrows indicate those without T302 and/or S303 residues. Inserts indicate total phosphorylated proteins before TPCK-trypsin digestion and ovals indicate the loading origins. Bottom panel: 1000 cpm (IV) or 4000 cpm (V) of POU2 WT phosphopeptide was either mixed with trypsin-digested His-Oct-2 POU or loaded alone, respectively. (C) Analysis of transactivation by potential PKC target mutants of Oct-2 (top panel). Six micrograms of either pCG-FLAG-Oct-2RR, pCG-FLAG-Oct-2RR-T302A, pCG-FLAG-Oct-2RR-S303A, or pCG-FLAG-Oct-2RR-T302A/S303A was transiently cotransfected with 3 μg of pGL3-VE/1–4GG into M12 cells in the presence of 50 μg/ml LPS for 23 hr before luciferase assays. The amount of FLAG-tagged Oct-2 proteins expressed was verified by immunoblotting with M5 anti-FLAG antibodies (bottom panel). Immunity 1999 11, 517-526DOI: (10.1016/S1074-7613(00)80127-2)

Figure 6 Protein–Protein Interaction between Oct-2 and OCA-B (A) EMSA analysis of potential alanine mutants. Nuclear extracts were prepared from transfectants used in previous transfection experiments, and EMSA was performed using octGG as the probe (see Experimental Procedures). Equal amounts of total nuclear proteins, as judged by the Bradford assay, containing Oct-1RR (lanes 3 and 4), Oct-2RR (lanes 5 and 6), Oct-2RR-T302A (lanes 7 and 8), Oct-2RR-S303A (lanes 9 and 10), or Oct-2RR-T302A/S303A (lanes 11 and 12) were used. Lanes 1 and 2 showed nuclear extracts from a mock transfection. GST-OCA-B (150 ng) was used in the supershift reactions (lanes 2, 4, 6, 8, 10, and 12). (B) Differential DNA binding by phosphorylated Oct protein. EMSA analysis of DNA binding by Oct-2 POU domains in the function of phosphorylation by PKA. Sixty nanograms of Oct-1 POU (lanes 3–5), Oct-2 POU (lanes 6–8), Oct-2 POU/302A (lanes 9–11), and Oct-2 POU/303A (lanes 12–14) from PKA kinase reaction were used (see Experimental Procedures). Reaction with the free probe (lane 1) and PKA alone (lane 2) was also shown. Immunity 1999 11, 517-526DOI: (10.1016/S1074-7613(00)80127-2)

Figure 7 Effects of OCA-B at the 3′ IgH Enhancer M12 was transiently cotransfected with pGL3-VE/1–4GG alone (black bar), 2 μg pCATCH-Bob-1/OCA-B (dotted bar), or pCG-Oct-2RR alone (gray bar), or in combination with either 6 μg of pCG-Oct-2RR or various alanine mutants of Oct-2RR (hatched bars). Enhancer reporter activities were measured 23 hr after electroporation in the presence of 10 μg/ml LPS. Immunity 1999 11, 517-526DOI: (10.1016/S1074-7613(00)80127-2)