Genes and Protein Synthesis Review

The Components of DNA DNA is a nucleic acid made up of monomers called nucleotides joined into long strands or chains by covalent bonds.

Recall: Nucleotides are made of A phosphate group A nitrogenous base A 5-carbon sugar  deoxyribose

Nitrogenous Bases and Covalent Bonds The nucleotides in a strand of DNA are joined by covalent bonds formed between their sugar and phosphate groups.

Nitrogenous Bases and Covalent Bonds The nucleotides can be joined together in any order, meaning that any sequence of bases is possible.

4 Different Nitrogenous bases Make Up DNA Adenine  A Cytosine  C Guanine  G Thymine  T

Forming the Double Helix Composed of sugar-phosphate strands ( two of them) held together by hydrogen bonds

The Role of DNA The DNA that makes up genes must be capable of storing, copying, and transmitting the genetic information in a cell.

Storing Information The sequence of bases allows the storing of information, all in a 4 letter alphabet.

RNA Ribonucleic acid Principle molecule that carries out the instructions coded in DNA

RNA vs. DNA 1. RNA contains ribose instead of deoxyribose 2.RNA contains uracil instead of thymine 3. RNA is a single strand instead of double-strand

The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA into RNA. RNA then uses the base sequence copied from DNA to direct the production of proteins.

The three main types of RNA are messenger RNA (mRNA), ribosomal RNA (rRNA), and transfer RNA (tRNA).

Messenger RNA (mRNA) Messenger RNA carries information from DNA to other parts of the cell.

Ribosomal RNA (rRNA) Ribosomal RNA (rRNA) aids in the assembly of proteins and also makes up part of the ribosome.

Transfer RNA (tRNA) When a protein is built, a transfer RNA (tRNA) molecule transfers each amino acid to the ribosome as it is specified by the coded messages in mRNA.

Transcription During transcription, segments of DNA serve as templates to produce complementary RNA molecules.

In eukaryotes, RNA is produced in the cell’s nucleus and then moves to the cytoplasm to play a role in the production of proteins.

RNA Polymerase Transcription requires an enzyme, known as RNA polymerase. uses one strand of DNA as a template from which to assemble nucleotides into a complementary strand of RNA.

Transcribe the DNA to RNA ATGCTAGATGATAGC UACGAUCUACUAUCG

Promoters RNA polymerase binds only to promoters, regions of DNA that have specific base sequences, showing RNA polymerase exactly where to begin. Similar signals in DNA cause transcription to stop when a new RNA molecule is completed.

RNA EDITING RNA molecules sometimes require bits and pieces to be cut out of them before they can go into action.

Genetic Code The sequence of amino acids that give a person his or her genetic information.

The Genetic Code The first step in decoding genetic messages is to transcribe a nucleotide base sequence from DNA to RNA. This transcribed information contains a code for making proteins. This genetic code is then read three “letters” at a time, so that each “word” is three bases long and corresponds to a single amino acid.

Proteins are made by joining amino acids together into long chains, called polypeptides. As many as 20 different amino acids are commonly found in polypeptides.

The specific amino acids in a polypeptide, and the order in which they are joined, determine the properties of different proteins, such as shape of the protein, which in turn determines its function…. RNA contains four different bases: A, G, C, and U that form a “language,” or genetic code, with just four “letters”.

Each three-letter “word” in mRNA is known as a codon. A codon consists of three consecutive bases that specify a single amino acid to be added to the polypeptide chain.

The order of amino acids to be added to the chain is specified in DNA molecules. Every group of three nucleotides, or one codon, specifies one amino acid.

mRNA : AAACAGGCA Codons: AAA—CAG—GCA

Examples: Example 1: mRNA: AUGGUGGCCCCUUGA CODONS: __________________________________________   Example 2: mRNA: AUGUUUGUGGGCAAGUGA CODONS: __________________________________________

Start and Stop Codons The genetic code has punctuation marks. The methionine codon AUG serves as the initiation, or “start,” codon for protein synthesis. Three codons serve as stop signals. These three codons---UAA, UAG, and UGA--- signify the end of a genetic message just like a period signifies the end of a sentence.

Example 1: GGA codes for ______ Example 2: AGU codes for ______ Example 3: UGG codes for ______

Translation The decoding of a mRNA message into a protein is a process known as translation.

Steps in Translation Messenger RNA is transcribed in the nucleus and then enters the cytoplasm for translation.

A ribosome attaches to a mRNA molecule in the cytoplasm. As the ribosome reads each codon of mRNA, it directs tRNA to bring a specified amino acid to the ribosome. One at a time, the ribosome then attaches each amino acid to the growing chain.

Which amino acid is next? Each tRNA molecule carries just one kind of amino acid. A tRNA molecule has three unpaired bases, collectively called the anticodon—which is complementary to one mRNA codon.

For example, the tRNA molecule for methionine has the anticodon UAC, which pairs with the methionine codon, AUG.

Once the amino acid forms a peptide bond with the growing polypeptide chain, the tRNA is released to bring another same amino acid as needed.

The central dogma of molecular biology is that information is transferred from DNA to RNA to protein.

Gene: A region of DNA that codes for a particular protein Gene expression: the process by which genetic information is used to make a protein DNA specifies the amino acid sequence in a protein, which play a key role in producing traits

One of the most interesting discoveries of molecular biology is the near-universal nature of the genetic code, always read three bases at a time and in the same direction. Despite their enormous diversity in form and function, living organisms display remarkable unity at life’s most basic level, the molecular biology of the gene.

Translate the following sequence of mRNA below. Make sure to separate each codon into groups of three. mRNA: AUGUCAGACGAAAAAGAUAUAUGGCACUAG Codons: _________________________________________________ Amino acid sequence : __________________________________

PROTEIN SYNTHESIS 1. DNA serves as a template for mRNA production in the nucleus. 2. mRNA moves from the nucleus to the cytoplasm. 3. mRNA attaches to a ribosome.

4. tRNA brings amino acids for a specific codon 5. amino acids are bonded together