RNA Structure and Protein Synthesis

Slides:



Advertisements
Similar presentations
MOLECULAR GENETICS. DNA- deoxyribonucleic acid James Watson and Francis Crick discover the structure of the DNA molecule DNA is a double helix (twisted.
Advertisements

TRANSLATION/PROTEIN SYNTHESIS Unit 4 – Part 1. Central Dogma DNA mRNA Proteins Traits.
The Structure of RNA RiboNucleic Acid
RNA & Protein Synthesis.
DNA Chapter 12. DNA DeoxyriboNucleic Acid Sugar = deoxyribose Adenine + Thymine Guanine + Cytosine Double-stranded helix with alternating sugars and phosphate.
Protein Synthesis. DNA in the Cell The Central Dogma DNA  RNA  Protein.
Chapter From DNA to Protein.
Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.
RNA and Protein Synthesis
DNA, mRNA, and Protein Synthesis TAKS Review for April 22 test.
DNA & RNA Replication & Transcription Central Dogma: DNA—RNA--Protein.
Chapter 13 –RNA and Protein Synthesis
Structure of DNA DNA is made up of a long chain of nucleotides
PROTEIN SYNTHESIS Review. Cell organelle where ______________ proteins are made Copying DNA _________________ G roup of 3 nucleotides _____________ in.
Do you know what this is?. DNA Stands for Deoxyribose Nucleic Acid It is a long molecule called a polymer Shape: double helix.
Molecules to Eye Color DNA, RNA and Protein Synthesis.
What is the ultimate job of the cell?. TO MAKE PROTEINS!
Molecules to Eye Color DNA, RNA and Protein Synthesis.
DNA, RNA & Protein Synthesis. A. DNA and the Genetic Code 1. DNA controls the production of proteins by the order of the nucleotides.
Protein Synthesis DNA&RNA DNA Deoxyribonucleic Acid Deoxyribonucleic Acid Shape - double helix - twisted ladder Shape - double helix - twisted ladder.
NUCLEIC ACIDS. There are two main types of Nucleic Acids: RNA and DNA.
Nucleic Acids and Protein Synthesis How we make the proteins that our body is made of.
Genetics.
RiboNucleic Acid-RNA RNA is responsible for the movement of genetic information from the DNA in the cell nucleus to the site of protein synthesis in the.
DNA Structrue & Function
RNA Ribonucleic Acid Single-stranded
Protein Synthesis.
Protein Synthesis From genes to proteins.
Structure and Role of DNA
How to Make a Protein?.
Day 2- Protein Synthesis
DEOXYRIBONUCLEIC ACID
Protein Synthesis.
Protein Synthesis.
Biology Unit 4 Notes: RNA & Protein Synthesis
RNA Another Nucleic Acid.
Chapter 11: From DNA to Protein
Transcription Modeling
Protein Synthesis.
Protein Synthesis.
RNA 3 Differences Between DNA and RNA RNA - ribonucleic acid
Objective: Journal: Describe the process of protein synthesis
Nucleic Acids Made of Nucleotides
Why do we use mice to conduct medical experiments?
Nucleic Acids and Protein Synthesis
RNA.
Chp: 12 Transcription & Translation
DNA and Genes Chapter 11.
RNA
DNA & Protein Synthesis
PROTEIN SYNTHESIS.
DNA Molecules DeoxyriboNucleic Acid Sugar = Deoxyribose
Analyze the process of DNA replication.
RNA and Transcription DNA RNA PROTEIN.
Nucleic Acids: RNA Ribonucleic Acid: RNA
January 11, 2018 Objective: Journal:
RNA: Structures and Functions
DNA and Genes Chapter 13.
Protein Synthesis Part 1
Making Proteins Transcription Translation.
Genes and Protein Synthesis Review
7.3 RNA and Protein Synthesis
Nucleic Acids And Protein Synthesis
Transcription and Translation
Transcription & Translation
RNA.
DNA and RNA.
DNA, RNA, and Protein Synthesis
Unit 3: Genetics Part 1: Genetic Informaiton
Warm-UP Name the enzyme that breaks the Hydrogen bonds between the nitrogen bases during DNA Replication. Name the enzyme that proofreads the newly made.
Presentation transcript:

RNA Structure and Protein Synthesis GT Biology Feb. 23, 2011 RNA Structure and Protein Synthesis

Warm-up How does DNA replicate? What is the central dogma? Quiz on Thursday March 3rd

Objective SWBAT explain the structure of RNA, its role in protein synthesis and how proteins are synthesized

Homework Read pgs 190-192 Complete questions 1-6

Today RNA Structure Types of RNA

RNA Structure

What is RNA? RiboNucleic Acid It is involved in the relaying of genetic information from DNA to the cytoplasm of the cell to produce proteins The production of proteins is known as protein synthesis RNA is found in the nucleus and the cytoplasm

RNA Structure Like DNA, RNA is made of nucleotides which contain: A sugar called ribose A phosphate group One of 4 nitrogenous bases Cytosine Guanine Adenine Uracil (this is in the place of thymine)

RNA Structure Cont. Single helix There are 3 types of RNA: Messenger RNA (mRNA) Transfer RNA (tRNA) Ribosomal RNA (rRNA)

Messenger RNA (mRNA) Carries the genetic information from the DNA in the nucleus to ribosomes in the cytoplasm

Transfer RNA (tRNA) Match the proper amino acid with the mRNA code to produce a protein Each tRNA contains an anticodon which contains 3 bases the correspond the codons on the mRNA Amino Acid

Ribosomal RNA (rRNA) Make up the ribosome (this is where proteins are made) These also allow mRNA to attach to the ribosome

Contain the genetic information DNA vs RNA Type of Nucleic Acid DNA RNA Sugar Nitrogenous Bases Structure Location Function Deoxyribose Ribose A,T,G,C A,U,G,C Double Helix Single Helix Nucleus and Cytoplasm Nucleus Contain the genetic information Protein formation

Protein synthesis

http://www.youtube.com/watch?v=8dsTvBaUMvw

Protein Synthesis Begins in the nucleus with the DNA mRNA is created by a process called transcription

Transcription The first step in transcription is to “unzip” the DNA Just like in replication this means the weak hydrogen bonds must be broken Next RNA polymerase matches complimentary RNA to the DNA C with G A with U instead of T Once the mRNA has been created the DNA strand closes back up

Transcribe the DNA DNA: ATGGCACTGCAT mRNA: UACCGUGACGUA

Translation After transcription the mRNA leaves the nucleus and enters the cytoplasm Once in the cytoplasm the mRNA attaches to a ribosome to begin making proteins The ribosome moves down the mRNA and “reads” the information The information on mRNA is read in codons (a groups of 3 bases)

Codons 3 bases make up 1 codon Each codon corresponds to a specific amino acid Amino acids are the building blocks of proteins Amino acids can be found free floating in the cytoplasm To determine what amino acid each codon codes for there is a codon table

ACU CGA GGC UAA Thr Arg Gly STOP

Translation The end of the protein is signaled by the reading of 1 of the 3 stop codons The series of amino acids produced by the ribosome create a protein Each protein produced plays a specific role in the appearance and behavior of the organism

http://www.youtube.com/watch?v=983lhh20rGY

Putting It All Together Beginning in the nucleus, DNA is unzipped so mRNA strands can be created from the template The mRNA strand exits the nucleus and enters the cytoplasm The mRNA attaches to the ribosome which is composed of rRNA The ribosome reads the mRNA with each codon producing a different amino acid, the amino acids are brought in by tRNAs The amino acids string together to create proteins

The Central Dogma DNA RNA Protein

What Protein Is Produced? DNA: GTTATCCTTCGCAATCACATTGCG mRNA: Protein: GUUAUGGAAGCGUUAGUGUAACGC --- Met Glu Ala Leu Val STOP ---

Practice http://learn.genetics.utah.edu/units/basics/transcribe/