Enter Date Aim: Making Proteins Warm-up: HW:

Bodies → Cells → DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA

DNA → Proteins → Cells → Bodies DNA has the information to build proteins proteins cells DNA gets all the glory, Proteins do all the work bodies

Cell organization DNA DNA is in the nucleus genes = instructions for making proteins want to keep it there = protected “locked in the vault” cytoplasm nucleus

Cell organization Proteins chains of amino acids made by a “protein factory” in cytoplasm protein factory = ribosome cytoplasm nucleus build proteins ribosome

Passing on DNA information Need to get DNA gene information from nucleus to cytoplasm need a copy of DNA messenger RNA cytoplasm nucleus build proteins mRNA ribosome

From nucleus to cytoplasm transcription DNA mRNA protein translation trait nucleus cytoplasm

DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded

Transcription Making mRNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase

Decoded Information Once DNA becomes RNA it can then help the body make proteins. The RNA strand contains instructions for making proteins The ribosome can read the instructions and make the required proteins.

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

RNA Polymerase Used in transcription. It binds to DNA and separates the DNA strands. It then uses one DNA strand as a template and produces a complimentary RNA strand.

Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

cytoplasm protein nucleus ribosome trait U C A G

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codons ribosome ribosome AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein Codon block of 3 RNA bases

The mRNA code Start codon Stop codons AUG methionine UGA, UAA, UAG Several codons for each amino acid mutation insurance! Start codon AUG methionine Stop codons UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory.

How are the codons matched to amino acids? DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

mRNA to protein = Translation The working instructions → mRNA The reader → ribosome The transporter → transfer RNA (tRNA) ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C C tRNA aa A G U

DNA mRNA protein trait From gene to protein tRNA aa aa transcription translation DNA mRNA protein ribosome U C A G tRNA aa trait nucleus cytoplasm

RNA Editing The new RNA strand is edited before it is used. Exons are regions of the RNA that will code for proteins. Introns are random regions that must be cut out before the strand can become mRNA.

Types of RNA Three Types of RNA: Messenger RNA Ribosomal RNA Transfer RNA

Messenger RNA Carry the instructions for assembling amino acids into proteins They serve as the messenger from DNA to the rest of the cell

Ribosomal RNA Ribosomal RNA makes up a majority of the ribosome. It is found in proteins

Transfer RNA During protein synthesis, tRNA transfers each amino acid to the ribosome as it is specified based on the mRNA instructions. Each tRNA can only carry one specific amino acid.