Catalyst.

Slides:



Advertisements
Similar presentations
Section 8.3: DNA Replication
Advertisements

Goal: Students will be able to explain how DNA was identified as the genetic material, describe the basic processes of replication, transcription, and.
DNA Replication.
DNA Replication. Cell Division and DNA Replication Cells divide -->Growth, Repair, Replacement Before cells divide they have to double cell structures,
DNA Replication. Why is DNA Replication needed? When cells are dividing… During Interphase of Mitosis & Meiosis DNA must be copied so that each new cell.
DNA Structure, Function and Replication
DNA Replication What is it? How does it happen? Why does it happen?
Replication. The Central Points of Protein Synthesis Are: DNA duplicates itself in replication. DNA produces RNA in transcription. RNA produces proteins.
DNA Replication – 2 12 BIO 9 May Matching terms - Quiz 1.the outcome of DNA replication 2.half of each replicated DNA is ‘parent’ DNA 3.the replication.
DNA Replication Replication is the process by which DNA is copied. Watson and Crick realized that a single strand can serve as a template or pattern for.
Set up Cornell Notes on pg. 5
DNA Replication. When and why must the DNA molecule be copied? Before cell division the DNA must be copied so that any new cells will have an identical.
8.3 DNA Replication KEY CONCEPT General Description: DNA replication copies the genetic information of a cell.
{ DNA Replication.  When DNA makes an exact copy of itself.  Required step before cell division (making new cells).  DNA is the template / Enzymes.
8.3 DNA Replication KEY CONCEPT DNA replication copies the genetic information of a cell.
8.3 DNA Replication TEKS 3E, 5A, 9C The student is expected to: 3E evaluate models according to their limitations in representing biological objects or.
DNA Replication EQ: How does the cell replicate the DNA in preparation for nuclear division. 1.
DNA Replication.
DNA Replication.
DNA Replication.
Higher Human Biology Sub topic 2b
DNA Replication.
Catalyst What did you enjoy most about winter break?
KEY CONCEPT DNA replication copies the genetic information of a cell.
DNA Replication.
KEY CONCEPT DNA replication copies the genetic information of a cell.
Bell Work What are the base pairs?
KEY CONCEPT DNA replication copies the genetic information of a cell.
DNA Replication.
7.2 DNA REPLICATION What are the steps in DNA replication?
DNA Replication.
DNA Replication.
DNA Replication.
February 5, 2016 Objective: To be able to explain and model how DNA replicates To describe how the structure of DNA relates to how it replicates Journal:
Chapter 12 Section 3 DNA Replication
5.3 DNA Replication.
DNA Replication.
DNA Replication Essential Question: How do enzymes help ensure DNA is copied correctly?
KEY CONCEPT DNA replication copies the genetic information of a cell.
1) To describe how the structure of DNA allows it to copy itself
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
DNA Replication.
About how many cells are our bodies made of?
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
BELLRINGER DNA is an example of what type of macromolecule?
KEY CONCEPT DNA replication copies the genetic information of a cell.
Steps of DNA Replication
DNA Replication Notes.
DNA Structure and Replication REVIEW
DNA Replication.
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
Replication 1 DNA 2 DNA.
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
8.3 DNA replication.
DNA Replication Hydrogen bonds Nucleotide Sugar-phosphate backbone Key
Year 12 Biology Macromolecules Unit
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
KEY CONCEPT DNA replication copies the genetic information of a cell.
DNA REPLICATION KEY CONCEPTS: What are the steps in DNA Replication?
Presentation transcript:

Catalyst

Big Goals All students will develop, run, and present an original lab study. 100% Proficient; 90% Advanced At least 80% mastery on all EOC and college level questions At least 5 points of growth on the ACT

Survey

Announcements

Hook http://www.thetech.org/genetics/common.php

SWBAT summarize the primary purpose of DNA replication SWBAT summarize the primary purpose of DNA replication. SWBAT explain why DNA replication is considered semi-conservative. SWBAT describe the role of enzymes in DNA replication. SWBAT demonstrate DNA replication by creating a complementary strand of DNA for a given DNA template.

I. What is DNA Replication? -DNA Replication is when DNA makes a copy of itself. -When DNA replicates it produces two DNA molecules that are identical (exactly the same) as the original parent strand: Picture of DNA Replication: DNA Replication 1 DNA 2 DNA

II. Steps of DNA Replication Step 1: Weak hydrogen bonds are broken by enzymes and DNA strands begin to unzip. Step 2: Free nucleotides join the open DNA to form 2 new DNA molecules. Step 3: There are 2 new molecules of DNA which are exact copies of each other. Each DNA molecule has one old strand and one new strand.

II. Steps of DNA Replication Continued Step 3: Enzymes “zip” up the newly synthesized DNA. Step 4: There are 2 new molecules of DNA which are exact copies of each other. Each DNA molecule has one old strand and one new strand.

Semi-Conservative DNA replication is semi-conservative, because each new double helix contains one original strand and one new strand.

III. Why is DNA Replication Important? -DNA Replication happens when cells divide to form two new cells. It is important that DNA replication happens because it allows each of the new cells to have DNA . -DNA Replication happens in the nucleus of a cell. -DNA Replication is important because cells need DNA to make proteins they need to survive. -DNA Replication allows a cell to pass down its genetic information to the next generation.

Practice with DNA Replication -Let’s practice DNA replication! I’ll give you one strand of DNA, and you complete the complementary strand of DNA. (Remember, A=T, G=C) Original Strand: ATTAGGCTATTGACGATAGCCATGGA Complementary Strand: TAATCCGATAACTGCTATCGGTACCT

Practice with DNA Replication Original Strand: GCCATAGGATTTATATGGCATAT Complementary Strand:

Practice with DNA Replication Original Strand: GCCATAGGATTTATATGGCATAT Complementary Strand: CGGTATCCTAAATATACCGTATA Original Strand: CGTAATGCGGATAGTTCACGTAT Original Strand: GCTATTACGAATCGTTACGAGG