Transcription and Translation How we make proteins from our DNA

DNA DNA is the blueprint of life because it contains the instructions to make the proteins of a cell. What are proteins made of? amino acids The DNA instructions are written in a code of nucleic acids: A, T C, G Why is DNA called the blueprint of life?

Question to be answered today How do we make proteins from DNA?

Nucleotides DNA is made of many nucleotides linked together. Each nucleotide is made of deoxyribose (a sugar molecule), a phosphate group, and a nitrogenous base (A,T,C,G).

The nucleotides connect together to form a long strand. DNA is made of 2 strands of nucleotides that connect and then twist. This shape is called a double helix. Hydrogen bonds connect the nitrogenous bases and hold the DNA strands together. {Point to the 3-D model to show the parts as you discuss them.}

DNA Replication DNA DNA double helix unwinds. Helicase breaks hydrogen bonds. DNA Polymerase forms a new strand using complementary base pairs (A & T, C & G)

Step 2: Complementary base pairs are added. Makes 2 identical strands of DNA Step 1: Replication fork Helicase DNA polymerase

Transcription & Translation Making proteins from DNA Proteins are made in the cell outside of the nucleus, DNA cannot leave the nucleus The cell needs a mechanism to get the DNA instructions to the cytoplasm This mechanism is RNA.

Transcription and Translation: Making proteins from the DNA in our nucleus RNA Protein Translation Transcription

DNA vs. RNA DNA RNA Double stranded (2) Single stranded (1) Deoxyribose sugar Bases: C G A T RNA Single stranded (1) Ribose sugar Bases: C G A U (uracil)

Transcription: the first stage of making a protein RNA polymerase attaches to the DNA molecule. The DNA unravels and separates at that spot. RNA polymerase reads the DNA code and forms a mRNA chain. RNA does not have thymine, so adenine pairs with uracil. C-G A-U RNA Polymerase

TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG UGC UAU GGG ACU ATCTGGATTACGATATGCCATATAGGC

mRNA: messenger RNA mRNA - the RNA that records instructions from the DNA carries it to a ribosome outside of the nucleus.

RNA polymerase RNA polymerase- an enzyme with 2 functions: Unwind DNA sequence Produce mRNA by reading the DNA code and stringing together a chain of RNA nucleotides

Translation: the second stage of making a protein Now that mRNA is transcribed from the DNA. It leaves the nucleus through a nuclear pore. Once in the cytoplasm, it attaches to a ribosome and translation begins.

Synthesis: to make something

Ribosomal RNA The ribosome is called rRNA. 2 units that are separate in the cytoplasm until they begin translation, then they join together. 1 Large unit 1 Small unit

tRNA: transfer RNA Transfer RNA – tRNA Attached to an amino acid on one end. Attached to an anticodon on the other end.

tRNA: transfer RNA The tRNA that matches the RNA attaches to the RNA at the ribosome and transfers the amino acid that it’s carrying. Amino acids connect using a peptide bond and form an amino acid chain.

Reading the DNA code Every 3 mRNA nitrogenous bases codes for 1 amino acid. Codon- nucleotide triplet (3) that codes for 1 amino acid.

tRNA Function tRNA lines up amino acids using mRNA code and connects them using peptide bonds. Amino acid chains form proteins that the cell needs. Amino acids must be in the correct order in order to form the correct protein.

DNA mRNA tRNA Amino acid Protein Drops off Peptide bond together to form Protein

The Genetic Code