Mutations Notes.

Slides:

Advertisements

Similar presentations

Chapter 17.5 Gene expression and Mutations

Advertisements

Do Now Check, in your notes Replicate this DNA strand: CATCGG Transcribe this DNA strand in to RNA: CATAGG Write 3 differences between DNA and RNA.

Mutations are changes in genetic material

To demonstrate understanding, after this lesson, you should be able to  define mutations  explain how mutations occur when – DNA Replication or Meiosis.

Mutations. DNA Mistakes DNA is a molecule that replicates, works and copies with very high accuracy DNA has enzymes that make sure that it works with.

Gene Mutations Chapter 11.

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

Mutations Learning Goal: Identify mutations in DNA (point mutation and frameshift mutation caused by insertion or deletion) and explain how they can affect.

Point Mutations Silent Missense Nonsense Frameshift.

Welcome to Genetic Mutations! 7x2WSY 7x2WSY.

Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.

Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Mutations. I. Mutations -any change in DNA sequence (order of nucleotides) is a mutation. -mutations can occurr during DNA replication, transcription,

Unit 6 Notes: Mutations. DNA Mutations Mutations: Any change in the sequence of nitrogenous bases of DNA. Causes: – Mutagens = factors that change chemical.

MUTATIONS No this can’t happen with just mutations.

Genetic Mutations Occur in any organism, from people and other animals to plants, bacteria, fungi, and protists. A mutation is any change in the nucleotide.

Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.

DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

Mutation Notes: Chapter 11.

The Cell Cycle.

DNA/GENE MUTATIONS.

“How does it affect the protein?”

Gene Mutations.

Protein Folding.

Gene Mutations.

Mermaid Syndrome Video.

Catalyst Create a circle map about mutations. Mutations.

Types of Mutations.

Gene Mutations Chapter 11.

The Central Dogma Through the production of mRNA (transcription), and the synthesis of proteins (translation), the information contained in DNA is expressed.

DNA and mutations SC.912.L.16.4.

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Protein Synthesis.

GOOD? BAD? NO EFFECT? MUTATIONS.

Catalyst Create a circle map about mutations. Mutations.

Types of point mutations

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

Mutations (Section 17-5) Now, that you know how gene expression works, let’s see how changes in the gene affect how the protein is made.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Do Now What is the central dogma of biology?

Mutations Section 12-4.

Changes in the nucleotide sequence of DNA or mRNA

DNA, RNA, and Proteins By Liz LaRosa

DNA, RNA, and Proteins By Liz LaRosa

Welcome to Genetic Mutations!

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

Mutation: Some Definitions

1) Base Mutations 2) Chromosomal Mutations

DNA, RNA, and Proteins By Liz LaRosa

Mutation Notes.

I. Mutations A change in the genetic code

Protein Synthesis and Mutation

Gene Regulation and Mutations

Gene Mutations.

Presentation transcript:

Mutations Notes

Mutagens The order of DNA is important so any changes can affect the protein being made DNA is constantly being exposed to mutagens Mutagens: physical or chemical agent that causes changes to the DNA A single base may be changed or a large section can be altered Ex: Sun, smoking, radiation, chemicals, even high temperatures There are two types of mutations Substitution/Point Frameshift: Insertion and deletion

5 Results of Mutations Silent mutation: When a base pair is substituted but the change still codes for the same amino acid in the sequence: Example: TCT and TCC both code for the amino acid Serine Substitution: When a base pair is substituted and the new codon codes for a different amino acid: Example: TCT codes for Serine and CCT codes for Proline Premature Stop: When a substitution results in the formation of a STOP codon before all of the codons have been read and translated by the ribosome: Example: GTGGTCCGAAACACC –– GTGGTCTGAAACACC Val-Val-Pro-Asn-Thr Val-Val-STOP

5 Results of Mutations 4. Codon Deletion or Insertion: A whole new amino acid is added, or one is missing from the sequence: Example: GTGGTCCGAAACACC –– GTGGTCTGCCGAAACACC Val-Val-Pro-Asn-Thr Val-Val-Cys-Pro-Asn-Thr 5. Frame Shift: When a deletion or insertion results in a different base pair being the beginning of the next codon, changing the whole sequence of amino acids Example: GTGGTCCGAAACACCT –– GTGGTCGAAACACCT Val-Val-Pro-Asn-Thr Val-Val-Glu-Thr-Pro

Substitution Where one base is switched with another one If a substitution changes the amino acid, it’s called a missense mutation If a substitution does not change the amino acid, it’s called a silent mutation If a substitution changes the amino acid to a “stop,” it’s called a nonsense mutation This is also called a point mutation because there is a change at a single place of DNA THE DOG BIT THE CAT THE DOG BIT THE CAR

Examples Missense Mutation Silent Mutation Nonsense Mutation AUGGUUUGC Methionine, Valine, Cytosine AUGGUUUGG Methionine, Valine, Tryptophan Silent Mutation AUGGUUUGU Nonsense Mutation AUGGUUUGA Methionine, Valine, Stop

Frameshift Insertion Deletion Base is added to the DNA Changes the rest of the “reading frame” Adding a “D” to THE DOG BIT DTH ECA T Deletion Base is removed from the DNA Also changes the reading frame Removing a “G” from THE DOB ITT HEC AT Frameshift can be more than a single base insertion or deletion An entire codon can be added or deleted

Example Insertion Deletion AUGGUUUGCA Methionine, Valine, Cytosine AUGAGUUUGCA Methionine, Serine, Leucine Deletion AUGGUUUGGA AUGGUUGCA Methionine, Valine, Alanine